ID: 1185620008

View in Genome Browser
Species Human (GRCh38)
Location X:1448223-1448245
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 6, 1: 27, 2: 16, 3: 32, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620005_1185620008 -2 Left 1185620005 X:1448202-1448224 CCATCTTGGACACACACCATCTT 0: 8
1: 9
2: 11
3: 58
4: 284
Right 1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG 0: 6
1: 27
2: 16
3: 32
4: 203
1185620001_1185620008 20 Left 1185620001 X:1448180-1448202 CCGCCATCTTGGATAAGCACCAC 0: 9
1: 4
2: 5
3: 28
4: 157
Right 1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG 0: 6
1: 27
2: 16
3: 32
4: 203
1185620002_1185620008 17 Left 1185620002 X:1448183-1448205 CCATCTTGGATAAGCACCACCAT 0: 16
1: 21
2: 42
3: 78
4: 178
Right 1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG 0: 6
1: 27
2: 16
3: 32
4: 203
1185620004_1185620008 1 Left 1185620004 X:1448199-1448221 CCACCATCTTGGACACACACCAT 0: 10
1: 8
2: 18
3: 47
4: 190
Right 1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG 0: 6
1: 27
2: 16
3: 32
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900035283 1:402652-402674 ATGGCTCCACACTGCCATCTTGG + Intergenic
900056904 1:638405-638427 ATGGCTCCACACTGCCATCTTGG + Intergenic
901383915 1:8894059-8894081 TTTGACACACATGGCCACCTTGG + Intergenic
903876254 1:26475428-26475450 TTTGACACACATGGCCACCTTGG + Exonic
905451340 1:38058771-38058793 TTGGACACACAAGGACACCTTGG - Intergenic
905999339 1:42410466-42410488 TTGGAGAAAAACTCCCATCTGGG + Intronic
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
908647947 1:66300036-66300058 TTGCACAAACACAGACATCTAGG + Intronic
909272503 1:73641978-73642000 TTGGACTCAGACTGACACCTGGG + Intergenic
909495976 1:76279163-76279185 TTGGACACACACAGCCAGGCAGG + Intronic
910057035 1:83045591-83045613 ATGGAAACACAATGGCATCTAGG + Intergenic
914932118 1:151944307-151944329 TTTGCCACACACTTCAATCTTGG - Intergenic
915336937 1:155149407-155149429 TTTGACACACATGGCCACCTTGG + Intergenic
922119843 1:222654385-222654407 TTAGACACAGACTGCAATATCGG + Exonic
922257813 1:223908212-223908234 ATGGCTCCACACTGCCATCTTGG + Intergenic
922952544 1:229571084-229571106 TTTGACACACATGGCCACCTTGG + Intergenic
924339011 1:243010991-243011013 ATGGCTCCACACTGCCATCTTGG + Intergenic
1063377268 10:5561810-5561832 TTGGAGTCACTCTGCCATCTTGG - Intergenic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1066157277 10:32691456-32691478 CTGGTCACACATTGCTATCTTGG + Intronic
1069863685 10:71486968-71486990 TTGGGCACAGACTGCCCACTGGG + Intronic
1072682319 10:97516362-97516384 TTGAACACACAGTGCCACCGTGG + Intronic
1075178741 10:120190042-120190064 TAGAACTCACACTGCCATCCAGG + Intergenic
1075192984 10:120328571-120328593 TTGGACATAAACAGCAATCTAGG - Intergenic
1078832660 11:14992155-14992177 ATGTACACCCACTGCCATATTGG - Intronic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1081449413 11:43157640-43157662 TTGTACACTCTCTGCCATATTGG + Intergenic
1081450835 11:43169535-43169557 TTGTACACTCTCTGCCATATTGG + Intergenic
1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG + Intergenic
1084261663 11:67983065-67983087 ATGCACACCCACTGCTATCTTGG - Intergenic
1084307574 11:68297071-68297093 TTGCACACAATCTGCCAACTTGG + Intergenic
1084810981 11:71611046-71611068 ATGCACACCCACTGCTATCTTGG + Intergenic
1084811844 11:71616762-71616784 TTGTACACACCCTGCGATATTGG + Intergenic
1085074736 11:73580791-73580813 TTTGACACACATGGCCACCTTGG + Intronic
1085578111 11:77625491-77625513 TTGTAGACACTCTGTCATCTGGG - Intronic
1086701818 11:89907106-89907128 GTGGACACACCCTGCGATATGGG + Intergenic
1086704350 11:89937419-89937441 GTGGACACACCCTGCGATATGGG - Intergenic
1091875976 12:3933127-3933149 TTGGGGACACTCTGCCCTCTAGG - Intergenic
1094324586 12:29222935-29222957 TTGCACACACACTGACAATTTGG + Intronic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1097003604 12:55899387-55899409 TTTGCCCCACAATGCCATCTTGG + Intergenic
1097432883 12:59530353-59530375 GCGGACACACACTGCGATTTGGG - Intergenic
1098875214 12:75859961-75859983 TAGGCCACACTCTGCCAACTTGG - Intergenic
1099086383 12:78251683-78251705 CTGGAGCCACACTGCCAGCTTGG + Intergenic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1102692250 12:114770519-114770541 GTGCATACCCACTGCCATCTGGG + Intergenic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1108474267 13:50798403-50798425 TGGGACATACACTGACACCTAGG + Intronic
1112146085 13:96701934-96701956 TTGGTCTCACTCTGTCATCTAGG - Intronic
1113843468 13:113373150-113373172 GTGGACATACACTGCCTCCTAGG + Intergenic
1114511289 14:23263609-23263631 TTTGACACACATGGCCACCTTGG - Intronic
1116519950 14:45835043-45835065 TTGTACACACCCTGCAATATTGG + Intergenic
1117413390 14:55471003-55471025 TTGGACACACAGACCAATCTTGG + Intergenic
1117941524 14:60971958-60971980 TTTGACACACATGGCCACCTTGG - Exonic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1118710812 14:68518097-68518119 TTGAACAAACGCTGCCTTCTGGG - Intronic
1121278711 14:92685312-92685334 CTGGACACACACTGGCAGCAGGG - Intronic
1121715570 14:96071571-96071593 GTGAACACACACTGCCCCCTGGG + Intronic
1122228846 14:100295056-100295078 TTGGATACTCAGTGCCACCTGGG + Intronic
1202900360 14_GL000194v1_random:32974-32996 TTGTACACACCCTGCAATATGGG - Intergenic
1124445858 15:29731262-29731284 TTTGACACACATGGCCACCTTGG + Intronic
1124454641 15:29829595-29829617 TTTGGCACTCCCTGCCATCTTGG - Intronic
1128186163 15:65645001-65645023 TGGGACAGCCACTGCCATGTGGG + Intronic
1131159787 15:90098166-90098188 TTGCACAAACACTGTCCTCTTGG + Intronic
1132179220 15:99739191-99739213 TTGGATACTGACGGCCATCTGGG - Intergenic
1135858295 16:26032239-26032261 TTTGACACACATGGCCACCTTGG - Intronic
1137062329 16:35802612-35802634 TTTGACACACATGGCCACCTTGG - Intergenic
1139298644 16:65925152-65925174 ATGGACACATACTGCAATTTGGG + Intergenic
1139661124 16:68421527-68421549 TTGCACAAACACTGCCAGGTTGG - Intronic
1144495240 17:15741601-15741623 ATGGGCAGACACTTCCATCTTGG - Intronic
1144638992 17:16927296-16927318 ATGGGCAGACATTGCCATCTTGG + Intergenic
1144921478 17:18767870-18767892 TGGGACAGACACTACCTTCTTGG - Intronic
1147753567 17:42753233-42753255 TTTGACACACATGGCCACCTTGG - Intergenic
1148760568 17:49997746-49997768 ATGGACCCACTCTGGCATCTTGG - Intergenic
1149784824 17:59425888-59425910 TTAGACACATGCTGTCATCTGGG - Intergenic
1150171824 17:63004404-63004426 TTTGACACACATAGCCACCTTGG - Intergenic
1150482847 17:65523936-65523958 TTTCACACAAACTGCCATCCTGG + Intergenic
1150870120 17:68898489-68898511 TTGGATTCAAATTGCCATCTGGG - Intronic
1152762241 17:82114924-82114946 TTGGCCCCACACTGCCATGGAGG + Intronic
1153837498 18:8977094-8977116 TTGGCCACACCCGGCCACCTTGG - Intergenic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1158434600 18:57427544-57427566 TTGGACCCCTACTGCCCTCTGGG + Intergenic
1159946622 18:74448612-74448634 GTGCACACACACTTCCCTCTTGG - Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1165976319 19:39680005-39680027 TGGGACACACACTGACACATGGG - Intergenic
1166238270 19:41472261-41472283 TTGTACACACCCTGCGATATTGG + Intergenic
1166244826 19:41517928-41517950 GTGGACACACCCTGCGATATTGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
931075770 2:58709960-58709982 TTGGACACTGACTGTCTTCTTGG + Intergenic
932314756 2:70772528-70772550 TTGGACACAAACTGGCATAAAGG + Intergenic
932350152 2:71024923-71024945 TTGTACACACACTTCGATATTGG + Intergenic
932353641 2:71051057-71051079 TTGTACACACACTTCGATATTGG + Intergenic
935959776 2:108413616-108413638 TTGGCCACACCCTGCCCTGTTGG + Intergenic
936024602 2:109021694-109021716 ATGGACACACACTGCCTGCGAGG - Intergenic
936492082 2:112980868-112980890 TTTGACACACATGGCCACCTTGG - Intronic
936893594 2:117401156-117401178 TGTGACACACACTGTGATCTGGG + Intergenic
937922049 2:127137714-127137736 CTTGTCACACCCTGCCATCTAGG - Intergenic
940018967 2:149136473-149136495 CTGGTGACCCACTGCCATCTGGG - Intronic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
943713699 2:191126616-191126638 CTGGCCACAGACTGCCCTCTGGG + Intronic
945230843 2:207587831-207587853 ATGGACACAAACTTACATCTAGG + Intronic
948696258 2:239734538-239734560 TTGGAAACACAGTGGCCTCTGGG + Intergenic
1168928263 20:1600235-1600257 TTGGACACACAGTCAGATCTGGG + Intronic
1173168171 20:40700749-40700771 TTGGAGACACTCTCCCTTCTGGG - Intergenic
1176619734 21:9047752-9047774 TTGTACACACCCTGCAATATGGG - Intergenic
1178632327 21:34273413-34273435 TTGGACATACACTTCCCTTTGGG + Intergenic
1181487346 22:23239778-23239800 TTGGATACAGACTGGCATATAGG - Intronic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1182741333 22:32570153-32570175 CTCCACACACACTGCCTTCTAGG + Intronic
1184785544 22:46669959-46669981 TGGGCCACACACTGGCATGTGGG + Intronic
949882505 3:8672820-8672842 ATGCACACCCACTGCTATCTTGG + Intronic
950073969 3:10174077-10174099 ATCCACACACACTCCCATCTTGG - Intronic
950778962 3:15374767-15374789 TTTGACACACATGGCCACCTTGG - Intergenic
957076735 3:75608645-75608667 ATGCACACCCACTGCTATCTTGG - Intergenic
960593906 3:119391063-119391085 TCCAACCCACACTGCCATCTTGG - Intronic
964601543 3:158506336-158506358 TGTGACACATACTCCCATCTCGG - Intronic
965779697 3:172271866-172271888 AAGGATAGACACTGCCATCTTGG + Intronic
965879922 3:173376429-173376451 TTGAACTTACACTGCCATTTTGG + Intergenic
968067889 3:195768936-195768958 CTGCACACACACTCCCATCCTGG - Intronic
969020188 4:4134940-4134962 ATGCACACCCACTGCTATCTTGG - Intergenic
969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG + Intronic
971598420 4:28561633-28561655 TTGGACACACACTGCATGCCAGG - Intergenic
973371193 4:49249687-49249709 TTGTACACCCACTGCGATATTGG - Intergenic
973389811 4:49545624-49545646 TTGTACACCCACTGCGATATTGG + Intergenic
973966259 4:56165028-56165050 ATGGCCAGAAACTGCCATCTGGG - Intergenic
975115515 4:70676469-70676491 TTGGACACAGAGTGCCCTATAGG - Intronic
976671254 4:87656620-87656642 TGGAACATACACAGCCATCTTGG - Intronic
976732507 4:88278409-88278431 CTGGACTCCCACTACCATCTGGG + Exonic
979238110 4:118424247-118424269 ATGGCTCCACACTGCCATCTTGG - Intergenic
979687463 4:123526686-123526708 TTGCACACACAGTGCCAGGTAGG - Intergenic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
985656746 5:1135847-1135869 TTTGACAAACAGTGCCAGCTTGG + Intergenic
988082497 5:26431617-26431639 TTGCAGACATATTGCCATCTTGG - Intergenic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
989173755 5:38499855-38499877 TTGGCCACACACTGGCTTCCTGG + Intronic
992101367 5:73410702-73410724 TTTGACACACATGGCCACCTTGG + Intergenic
992381455 5:76241721-76241743 TTTGACACACATGGCCACCTTGG - Intronic
994391478 5:99197429-99197451 GTGGACACCCTCTGCCATATTGG + Intergenic
994393124 5:99208158-99208180 TTGTACACCCACTGCGATATAGG + Intergenic
994396079 5:99226721-99226743 TTGTACACACCCTGCAATATTGG + Intergenic
994999740 5:107112185-107112207 TTGAACACATATTGCAATCTAGG - Intergenic
995710610 5:115031720-115031742 CAGGGCACTCACTGCCATCTGGG + Intergenic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
997686812 5:135794637-135794659 TTGTACACCCCCTGCGATCTTGG - Intergenic
1001876488 5:175206227-175206249 TTGGTCTCTCACTGGCATCTGGG + Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1002738536 5:181416219-181416241 ATGGCTCCACACTGCCATCTTGG - Intergenic
1003032185 6:2611448-2611470 TTGGACACAGAATGACAACTGGG - Intergenic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1009048525 6:58254398-58254420 TTGTACACACCCTGCAATATTGG - Intergenic
1009224393 6:61009156-61009178 TTGTACACACCCTGCAATATTGG - Intergenic
1009603673 6:65837537-65837559 TTGGATAAACTCTGCCTTCTAGG - Intergenic
1010625296 6:78131248-78131270 ATGGAAACACACTGCCATGAAGG + Intergenic
1010727702 6:79354157-79354179 TTTGACACACATGGCCACCTTGG - Intergenic
1011274080 6:85611651-85611673 CTGGACACTCACTGTCATCAAGG + Intronic
1011614895 6:89188839-89188861 TTGCACACACACAGACATCCTGG - Intronic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1013622026 6:111899326-111899348 TTCTACAAACACTGCCATTTCGG + Intergenic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1016869360 6:148801438-148801460 TTGGAAGCTCACTGCCATTTGGG - Intronic
1019243639 6:170691771-170691793 ATGGCTCCACACTGCCATCTTGG - Intergenic
1020307601 7:6846969-6846991 ATGCACACCCACTGCTATCTTGG - Intergenic
1020650929 7:10875262-10875284 CTGGACAGACACTGGCAGCTAGG - Intergenic
1021786768 7:24159990-24160012 TTGGACACTTACTGTGATCTTGG + Intergenic
1021942418 7:25690962-25690984 TTGGACTCAGACTGCCTTCCTGG - Intergenic
1023266364 7:38410366-38410388 CAGGCCCCACACTGCCATCTGGG - Intronic
1026261765 7:68761592-68761614 TTGAGTACACAATGCCATCTTGG + Intergenic
1027485826 7:78760731-78760753 TTGCACACACACTTACATATCGG - Intronic
1027556185 7:79667494-79667516 TTGGTGACACACTTACATCTAGG + Intergenic
1028941039 7:96522359-96522381 TAGGACACAAACTGCCAAATAGG - Intronic
1029078719 7:97955913-97955935 ATGCACACCCACTGCTATCTTGG - Intergenic
1029946084 7:104534401-104534423 TTCTACCCACACTTCCATCTCGG + Intronic
1031199366 7:118660239-118660261 TTGAATAGTCACTGCCATCTTGG - Intergenic
1035504483 8:116389-116411 ATGGCTCCACACTGCCATCTTGG + Intergenic
1039583574 8:38686418-38686440 TTGAACACACCCTTCCCTCTGGG + Intergenic
1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG + Intergenic
1044824658 8:96184534-96184556 TTGGACACACACTGAGTTCTAGG - Intergenic
1047378271 8:124326503-124326525 TTAGAACCACACTGCCTTCTCGG + Intronic
1049504113 8:142985735-142985757 TGGGACACACCCTGCCCTCCTGG + Intergenic
1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG + Intergenic
1050902304 9:10963792-10963814 ATGTACACCCCCTGCCATCTTGG + Intergenic
1052956888 9:34259562-34259584 TTACACACAACCTGCCATCTGGG + Intronic
1053433310 9:38058307-38058329 TGGGACACTCTCTGCCCTCTGGG - Intronic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1055890306 9:81116936-81116958 TTCAACACAGCCTGCCATCTGGG - Intergenic
1056180665 9:84079297-84079319 TTTGACACACATGGCCACCTTGG + Intergenic
1057247808 9:93472511-93472533 TTGGACACACAAGGCCAGTTTGG + Intronic
1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG + Intergenic
1057776890 9:98018680-98018702 TTCCACACTCACTGCAATCTTGG - Intergenic
1058519090 9:105801739-105801761 GTGTACACACACTGCGATATTGG + Intergenic
1058952182 9:109914219-109914241 TGAGGCACAAACTGCCATCTTGG - Intronic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1062068477 9:134541491-134541513 TTGGACACACACTGCACGCCAGG + Intergenic
1203554221 Un_KI270743v1:192330-192352 TTGTACACCCACTGCGATATTGG + Intergenic
1203567093 Un_KI270744v1:100761-100783 TTGTACACCCCCTGCCATATTGG - Intergenic
1203603828 Un_KI270748v1:40994-41016 ATGGCTCCACACTGCCATCTTGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186938163 X:14474081-14474103 TTGTACACACACAGCCACTTAGG - Intergenic
1187736015 X:22304253-22304275 TTGGAGAGAGACTGCCATGTTGG + Intergenic
1187938005 X:24354518-24354540 TTTGACACACATGGCCACCTTGG + Intergenic
1190722071 X:53157473-53157495 CTTGACACACTCTGCAATCTTGG + Intergenic
1192130379 X:68544060-68544082 TTGGCCTCTCACAGCCATCTTGG - Intergenic
1193873379 X:86829841-86829863 AGGGACACACACTGACATTTGGG - Intronic
1199999595 X:153051854-153051876 TTTGACACACATGGCCACCTTGG - Intergenic
1202385888 Y:24326039-24326061 ATGGCTCCACACTGCCATCTTGG - Intergenic
1202484898 Y:25344089-25344111 ATGGCTCCACACTGCCATCTTGG + Intergenic