ID: 1185620010

View in Genome Browser
Species Human (GRCh38)
Location X:1448242-1448264
Sequence TTGGATAAGCACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620007_1185620010 1 Left 1185620007 X:1448218-1448240 CCATCTTGGACACACACTGCCAT No data
Right 1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG No data
1185620004_1185620010 20 Left 1185620004 X:1448199-1448221 CCACCATCTTGGACACACACCAT No data
Right 1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG No data
1185620005_1185620010 17 Left 1185620005 X:1448202-1448224 CCATCTTGGACACACACCATCTT No data
Right 1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620010 Original CRISPR TTGGATAAGCACCACCATCT TGG Intronic