ID: 1185620025

View in Genome Browser
Species Human (GRCh38)
Location X:1448350-1448372
Sequence TTGGACCCATAACACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 2, 1: 1, 2: 0, 3: 8, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620022_1185620025 1 Left 1185620022 X:1448326-1448348 CCATCTGGGACACACACTGCCAT 0: 2
1: 5
2: 38
3: 80
4: 311
Right 1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG 0: 2
1: 1
2: 0
3: 8
4: 102
1185620018_1185620025 20 Left 1185620018 X:1448307-1448329 CCACCATCTTGGACACACACCAT 0: 10
1: 8
2: 18
3: 47
4: 190
Right 1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG 0: 2
1: 1
2: 0
3: 8
4: 102
1185620019_1185620025 17 Left 1185620019 X:1448310-1448332 CCATCTTGGACACACACCATCTG 0: 3
1: 8
2: 7
3: 28
4: 247
Right 1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG 0: 2
1: 1
2: 0
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620025 Original CRISPR TTGGACCCATAACACCATCT TGG Intronic
900361161 1:2289737-2289759 TTGGCCCCACAGCAGCATCTGGG + Intronic
904974959 1:34448994-34449016 TTGGACCCATAAACACCTCTAGG - Intergenic
906599520 1:47112943-47112965 TTGGAGCCATAGAACCATATGGG - Intronic
916491394 1:165305370-165305392 TATGACATATAACACCATCTGGG + Intronic
917287309 1:173434716-173434738 CCGGAACCATAATACCATCTGGG + Intergenic
1064006259 10:11701728-11701750 TGGGAACCATTACACCATCCTGG + Intergenic
1065180927 10:23124870-23124892 TTAGCCCCATAAAACGATCTGGG + Intergenic
1070377767 10:75850531-75850553 TTGCTCATATAACACCATCTGGG + Intronic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1077197503 11:1288725-1288747 CTGGACCCACATCACCATCCCGG - Exonic
1077918448 11:6625882-6625904 GTGGACCCAAGACCCCATCTTGG - Intronic
1079357910 11:19745382-19745404 TTGGGCCCCTAAAACTATCTTGG + Intronic
1088771978 11:113044210-113044232 TTGGACCCATAACTTCTTCTGGG + Intronic
1093458935 12:19391028-19391050 TTTGGTCCTTAACACCATCTGGG + Intergenic
1093650432 12:21637769-21637791 TTGGACCAGTTACACTATCTGGG + Intronic
1093712236 12:22340248-22340270 TTGGCCCCATGGCAGCATCTAGG - Intronic
1093712932 12:22348288-22348310 TTTGCCCCATGACAGCATCTAGG - Intronic
1094770934 12:33659058-33659080 TTTGCCCCAAAACTCCATCTTGG - Intergenic
1120080108 14:80206630-80206652 TTGGTCCCATAATAACATTTAGG + Intronic
1121269090 14:92625992-92626014 TTGGATCCAGAAGACCCTCTTGG - Intronic
1125094855 15:35839245-35839267 TTGCTTCCTTAACACCATCTGGG - Intergenic
1128875582 15:71198605-71198627 TCTGACCCATAACACCCTCTAGG - Intronic
1130047254 15:80455132-80455154 TTGGACTGCTATCACCATCTTGG - Intronic
1130927310 15:88395425-88395447 TTGACCCCATAGCAGCATCTAGG + Intergenic
1133586657 16:7202354-7202376 TTGGACCCATTACGCCCTGTGGG + Intronic
1134873627 16:17675908-17675930 TTGGCCCCATAGTAGCATCTAGG + Intergenic
1141041905 16:80679822-80679844 CTGGACCAATAGCAGCATCTAGG + Intronic
1143004204 17:3816974-3816996 GTGGAGCGATAACACGATCTCGG - Intronic
1153729082 18:7989351-7989373 TTAGCCCCAAACCACCATCTTGG + Intronic
1156920257 18:42513804-42513826 TTGGAGCCATGCCACCATTTTGG + Intergenic
1157655474 18:49383466-49383488 TTGGACAAATAAAACCTTCTTGG + Intronic
1164809366 19:31143970-31143992 TTGCAACCAAAACTCCATCTTGG + Intergenic
926237643 2:11058183-11058205 TTGCACTCTTAACTCCATCTTGG - Intergenic
926271298 2:11368627-11368649 TTGGCCCCATAATAACCTCTTGG + Intergenic
929047396 2:37803387-37803409 TTAGCCACATAACACCATTTTGG - Intergenic
931482844 2:62659651-62659673 TTGGACCGGTAGCACCACCTAGG + Intergenic
932117423 2:69065856-69065878 TTGGAGCCATAAGGCCATCTGGG + Intronic
933089525 2:78103901-78103923 TTGGACTCAGAACAACAACTCGG + Intergenic
942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG + Intronic
944009849 2:194961202-194961224 AAGGACACATAACAACATCTTGG + Intergenic
949079395 2:242084762-242084784 TTGTACCCATGGCACCATCGTGG + Intergenic
949079404 2:242084833-242084855 TTGTACCCATGACACCGTCGTGG + Intergenic
949079413 2:242084904-242084926 TTGTACCCATGACACCGTCGTGG + Intergenic
949079432 2:242085046-242085068 TTGTACCCATGACACCGTCGTGG + Intergenic
949079441 2:242085117-242085139 TTGTACCCATGACACCGTCGTGG + Intergenic
949079460 2:242085259-242085281 TTGTACCCATGACACCGTCGTGG + Intergenic
949079479 2:242085401-242085423 TTGTACCCATGACACCGTCGTGG + Intergenic
1168904183 20:1390968-1390990 TGAGACCCAGAACACCATCAGGG - Intronic
1175196750 20:57249193-57249215 AAGGACCTATAACACCCTCTGGG - Intronic
1178755965 21:35349993-35350015 TTGGACCCAGAAAAGCATCACGG - Intronic
1185373177 22:50470165-50470187 TTGGCCCCAAACCACCATCTGGG + Intronic
952232014 3:31441985-31442007 TTGGACCCAATACTTCATCTAGG - Intergenic
953204867 3:40817199-40817221 TTGGACCAGTAGCATCATCTGGG + Intergenic
967947402 3:194814910-194814932 TGGGACCCAGAAAACCACCTAGG + Intergenic
972570104 4:40302998-40303020 TTGCACCTCTAATACCATCTTGG - Intergenic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
977779535 4:100964483-100964505 TAGGAACCATATCATCATCTTGG + Intergenic
979214977 4:118152399-118152421 TTGGTCTCAGAACACCCTCTAGG - Intronic
979967648 4:127094720-127094742 TTGGACTCATACAACCATGTAGG - Intergenic
980452706 4:132996271-132996293 TTGAACCCATGAAACCATGTTGG - Intergenic
983238235 4:165204524-165204546 TTGTACACATAACACTATTTTGG + Intronic
984226622 4:177043207-177043229 TTTGACCCATAAAACAAGCTTGG - Intergenic
996011814 5:118489150-118489172 TTTAACCCATTACACTATCTTGG - Intergenic
996614772 5:125428126-125428148 TTGCATCCATACCACCATATAGG + Intergenic
997102561 5:130985097-130985119 TTTGACCCTTTACAACATCTTGG - Intergenic
997983441 5:138485276-138485298 TTGGACCCATCAATCAATCTGGG - Intergenic
999021057 5:148165708-148165730 TTAAAGCCATAAAACCATCTTGG + Intergenic
1000753563 5:165128294-165128316 TTAGAACCATTACTCCATCTTGG - Intergenic
1004749916 6:18551933-18551955 TTGGATCCATAACACCAAGATGG + Intergenic
1011197312 6:84794657-84794679 TTGAACAAATAATACCATCTTGG + Intergenic
1011479502 6:87779999-87780021 TTGGACCCAAAACAAAGTCTGGG - Intergenic
1011982376 6:93397558-93397580 TTGAACACATAACACTATCCTGG - Intronic
1013586326 6:111582232-111582254 TTTGACCCATGTCACCACCTGGG + Intronic
1021179984 7:17494891-17494913 TTGGCCCCACAGCAGCATCTAGG - Intergenic
1023382290 7:39621791-39621813 ATGGACACATATCACCATATTGG + Intergenic
1024086169 7:45893761-45893783 GCAGACCCAAAACACCATCTTGG - Intergenic
1039880633 8:41623316-41623338 TTTGCCCCATAAGACCAACTCGG - Exonic
1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG + Intergenic
1054997287 9:71407047-71407069 TAGGAAACATAAAACCATCTAGG - Intronic
1056876775 9:90340883-90340905 TTGTACTCATAATACCATTTTGG + Intergenic
1057059706 9:91992748-91992770 TGACACCCATTACACCATCTGGG - Intergenic
1057979581 9:99646903-99646925 ATGCACCCATAAAACCAACTGGG - Intergenic
1061887062 9:133596462-133596484 TGGGCCCCATTACCCCATCTTGG - Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619872 X:1447289-1447311 TTGGACCCATTACACCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1188344816 X:29051287-29051309 TTGAGTCCATAACACCATTTTGG - Intronic