ID: 1185620029

View in Genome Browser
Species Human (GRCh38)
Location X:1448369-1448391
Sequence TTGGACAAGCACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 23, 2: 6, 3: 29, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620022_1185620029 20 Left 1185620022 X:1448326-1448348 CCATCTGGGACACACACTGCCAT 0: 2
1: 5
2: 38
3: 80
4: 311
Right 1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG 0: 1
1: 23
2: 6
3: 29
4: 120
1185620027_1185620029 -10 Left 1185620027 X:1448356-1448378 CCATAACACCATCTTGGACAAGC 0: 2
1: 0
2: 1
3: 9
4: 89
Right 1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG 0: 1
1: 23
2: 6
3: 29
4: 120
1185620026_1185620029 -9 Left 1185620026 X:1448355-1448377 CCCATAACACCATCTTGGACAAG 0: 2
1: 0
2: 1
3: 8
4: 124
Right 1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG 0: 1
1: 23
2: 6
3: 29
4: 120
1185620024_1185620029 1 Left 1185620024 X:1448345-1448367 CCATCTTGGACCCATAACACCAT 0: 2
1: 1
2: 2
3: 18
4: 172
Right 1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG 0: 1
1: 23
2: 6
3: 29
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620029 Original CRISPR TTGGACAAGCACCACCATCT TGG Intronic
902717127 1:18280583-18280605 TAGCAATAGCACCACCATCTAGG - Intronic
904051904 1:27645055-27645077 TTGGCAAAGCACCACCCCCTGGG - Intergenic
909411963 1:75364608-75364630 TTGGGAAAACACCACCATCCAGG - Intronic
911477466 1:98391185-98391207 TTGGAATAGCAACACCATTTGGG - Intergenic
912729626 1:112090737-112090759 GTTCACAAGCACCACTATCTTGG - Intergenic
916793736 1:168146587-168146609 ATGGAAAAGCATTACCATCTGGG - Intergenic
1068050099 10:51939609-51939631 TTTGAGAAACACCACTATCTTGG + Intronic
1070982672 10:80662295-80662317 TTGGACCAGCAGCATCACCTAGG + Intergenic
1073120853 10:101121919-101121941 TTCGCCAGGGACCACCATCTGGG - Intronic
1074030090 10:109678346-109678368 TTGAACAAGCACTACAAACTGGG + Intergenic
1080798410 11:35587294-35587316 TTGGAGAAGCACCAAGATCAGGG - Intergenic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1085393499 11:76194522-76194544 TGGCACAAGCACAACTATCTGGG + Intronic
1088073391 11:105816872-105816894 ATGGGCATGCACCACCATCCAGG - Intronic
1090050199 11:123371240-123371262 TTGGGTAATCCCCACCATCTTGG + Intergenic
1092033612 12:5311078-5311100 TTGGGCAATCACCTCCACCTAGG + Intergenic
1101257015 12:102988701-102988723 TTAGAGAACCAGCACCATCTGGG - Intergenic
1102231655 12:111266727-111266749 GTAGAAAAGCACCACCAACTGGG - Intronic
1110277651 13:73658103-73658125 TTTCACAATCGCCACCATCTGGG - Intergenic
1113355457 13:109575932-109575954 TAGGAAAAGCACTACCTTCTGGG - Intergenic
1115016901 14:28628023-28628045 CTCTACAACCACCACCATCTAGG - Intergenic
1115489922 14:33949559-33949581 ATGGACATGCACCAACATCGCGG + Intronic
1118132869 14:62987024-62987046 ATGTACCAACACCACCATCTTGG + Intronic
1124107428 15:26753163-26753185 AAGGACCAGCTCCACCATCTGGG - Intronic
1125709314 15:41771959-41771981 GTGGTTAAGCAACACCATCTAGG - Intronic
1131544654 15:93305906-93305928 CTGGCCCAGAACCACCATCTAGG - Intergenic
1132233626 15:100202747-100202769 CTTGACAAGCACCAGCATATGGG - Intronic
1133921647 16:10158827-10158849 TGTGACCAGCACCTCCATCTAGG - Intronic
1135241616 16:20811952-20811974 TTGGACCATCATCATCATCTTGG - Intronic
1135560195 16:23470250-23470272 ATGGAGAAGCAACAGCATCTGGG - Intronic
1135861641 16:26061447-26061469 TTTGACCTCCACCACCATCTTGG + Intronic
1146453209 17:32991000-32991022 CTGCACATGCACCACCATCCTGG + Intronic
1151390415 17:73783331-73783353 CTGGACCAGCAGCAGCATCTGGG - Intergenic
1151960652 17:77403709-77403731 TTGGACAAACAGCACAGTCTGGG + Intronic
1158259326 18:55589913-55589935 GTCGACCAGCACCGCCATCTTGG - Intronic
1158830597 18:61273592-61273614 TTAGACAAGAGCCAGCATCTGGG + Intergenic
1159658656 18:71064593-71064615 TTGGTCAAGAATCACCATCCAGG - Intergenic
1161948526 19:7454091-7454113 TGGGATTAGCAGCACCATCTTGG + Intronic
1168057050 19:53869701-53869723 TTGGACAGGCTCCTCCCTCTAGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
932297986 2:70642637-70642659 TTGCACAAGCACCAGCAGCAGGG - Intronic
934565094 2:95334559-95334581 TTGTACAAGGCCCACCATGTTGG - Intronic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
942372064 2:175295711-175295733 TTGGGCAAGTATCAGCATCTGGG + Intergenic
943409504 2:187529384-187529406 TTGGACCAGCACCTTGATCTTGG - Intronic
946124659 2:217552054-217552076 TAAGACAAGCACTACCCTCTTGG + Intronic
1172036418 20:32013934-32013956 CTGGACCAGCAGCACCACCTAGG - Intronic
1173281458 20:41631914-41631936 CTGGACCAGCAGCAGCATCTAGG + Intergenic
1175284638 20:57829904-57829926 TTTGACAGGAACCACCCTCTCGG + Intergenic
1178179029 21:30138410-30138432 CTGAACAATGACCACCATCTTGG + Intergenic
952928049 3:38336295-38336317 TTTGAAAAGTACCACCAACTAGG + Intergenic
953204867 3:40817199-40817221 TTGGACCAGTAGCATCATCTGGG + Intergenic
953591723 3:44263022-44263044 TTGGAGAAGCATCATCATGTAGG + Intronic
954570893 3:51639930-51639952 GTGGAAAAGCAGTACCATCTTGG - Exonic
958110793 3:89141574-89141596 TTGGACAAGCACCATTAGCAAGG - Intronic
958999268 3:100942703-100942725 TTAGACAATCAACATCATCTGGG + Intronic
960906879 3:122610534-122610556 TTGGAGGAGGACCACTATCTCGG + Exonic
961495285 3:127287148-127287170 TGGGACCACCACCTCCATCTGGG - Intergenic
967600542 3:191382420-191382442 GTGGCCAAGCACACCCATCTAGG + Intronic
971635427 4:29050962-29050984 TCTGACAATCACAACCATCTGGG - Intergenic
972968336 4:44540858-44540880 TTTTACAAGGACCACCTTCTGGG + Intergenic
976087286 4:81419341-81419363 TGGGACTAGAACCACAATCTAGG - Intergenic
977392727 4:96432292-96432314 TTGGAATACCACCACCATATTGG + Intergenic
986773054 5:10990635-10990657 TTTAATAAACACCACCATCTGGG - Intronic
987195703 5:15523804-15523826 GTGGACACGCAACTCCATCTGGG - Intronic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
989416748 5:41186931-41186953 TTGGAAAAGCATTAGCATCTTGG - Intronic
990328278 5:54699348-54699370 ATGGAGAAGAATCACCATCTTGG - Intergenic
990417211 5:55597939-55597961 TTGGGCCAGCCCCACCATCTGGG - Intergenic
992293551 5:75304899-75304921 TGAGAGCAGCACCACCATCTTGG + Intergenic
996808720 5:127489041-127489063 GTGGGCAAGCATTACCATCTGGG - Intergenic
1002653317 5:180720810-180720832 TTGGCCTAGGAACACCATCTGGG + Intergenic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1011034671 6:82960001-82960023 GGGGACATGCACCATCATCTTGG + Intronic
1013047850 6:106505413-106505435 TAGGACAAGTTTCACCATCTTGG + Intergenic
1015546430 6:134366502-134366524 TTGCAGAAGCTCCACCATTTTGG - Intergenic
1018932906 6:168253553-168253575 CAGGAGAAGCACCATCATCTCGG - Intergenic
1020712982 7:11631804-11631826 TTAGATAAGCAACACCATTTTGG + Intronic
1021763575 7:23924975-23924997 TTGGAAATGCAGCAGCATCTAGG - Intergenic
1028035539 7:85976963-85976985 TAGCACAAGCAACACCATTTTGG + Intergenic
1030757479 7:113305822-113305844 ATAGACAATCACCACCAGCTTGG - Intergenic
1031781964 7:125979391-125979413 TAGCACAATCACCACCTTCTGGG - Intergenic
1034381813 7:150702499-150702521 TTGGACAAGCACAAAGATTTGGG + Intergenic
1035218512 7:157390121-157390143 TGGGACAGCAACCACCATCTGGG - Intronic
1037431609 8:18819010-18819032 CTGGACAAGCACCTACCTCTAGG + Intronic
1038044592 8:23755359-23755381 CTTGACAAGGAGCACCATCTAGG - Intergenic
1040568322 8:48586790-48586812 TTGGAGCAGCACCACCATGGCGG - Intergenic
1041087716 8:54272015-54272037 ATGGACAACAACCTCCATCTCGG + Intergenic
1041332216 8:56739294-56739316 TTGAACTAGCATCACCATCACGG - Intergenic
1043613859 8:82101201-82101223 TTGGAAAAGCATCTTCATCTAGG + Intergenic
1044585788 8:93868324-93868346 TTGGACAGCCAACACCATTTTGG - Intronic
1045702432 8:104882111-104882133 TGACAGAAGCACCACCATCTGGG - Intronic
1051135800 9:13919137-13919159 TTGGAAAAGCCCCACCATAATGG + Intergenic
1056685941 9:88759450-88759472 TTTCTCTAGCACCACCATCTGGG - Intergenic
1057373100 9:94491713-94491735 TTGGACAAGCAACAACACCTGGG - Intergenic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186177811 X:6943764-6943786 TTGGAAATGCAGCACCATTTAGG - Intergenic
1187136397 X:16551667-16551689 TAGCACAACCACCACCACCTTGG - Intergenic
1191741195 X:64436823-64436845 ATGGACAAGCATCCTCATCTTGG + Intergenic
1195010740 X:100730766-100730788 GTAGAAAAGCACCACCAACTTGG - Intronic
1196745104 X:119064768-119064790 TTGGACTAGTACCATCAGCTAGG - Intergenic
1197089477 X:122520242-122520264 CTGGACAAGCATCACAATCATGG + Intergenic
1198816138 X:140592756-140592778 TTTGACAAGCAGCACGAGCTCGG - Intergenic