ID: 1185620038

View in Genome Browser
Species Human (GRCh38)
Location X:1448422-1448444
Sequence TTGGATACACACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620031_1185620038 16 Left 1185620031 X:1448383-1448405 CCATCTTGGACACACCGCCATCT No data
Right 1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG No data
1185620033_1185620038 2 Left 1185620033 X:1448397-1448419 CCGCCATCTTGGACACGCCACCA No data
Right 1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG No data
1185620034_1185620038 -1 Left 1185620034 X:1448400-1448422 CCATCTTGGACACGCCACCATCT No data
Right 1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG No data
1185620030_1185620038 19 Left 1185620030 X:1448380-1448402 CCACCATCTTGGACACACCGCCA No data
Right 1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620038 Original CRISPR TTGGATACACACCACCATCT TGG Intronic