ID: 1185620038

View in Genome Browser
Species Human (GRCh38)
Location X:1448422-1448444
Sequence TTGGATACACACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 1, 2: 39, 3: 38, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620030_1185620038 19 Left 1185620030 X:1448380-1448402 CCACCATCTTGGACACACCGCCA 0: 2
1: 0
2: 1
3: 6
4: 125
Right 1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG 0: 1
1: 1
2: 39
3: 38
4: 138
1185620033_1185620038 2 Left 1185620033 X:1448397-1448419 CCGCCATCTTGGACACGCCACCA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG 0: 1
1: 1
2: 39
3: 38
4: 138
1185620034_1185620038 -1 Left 1185620034 X:1448400-1448422 CCATCTTGGACACGCCACCATCT 0: 1
1: 0
2: 3
3: 5
4: 111
Right 1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG 0: 1
1: 1
2: 39
3: 38
4: 138
1185620031_1185620038 16 Left 1185620031 X:1448383-1448405 CCATCTTGGACACACCGCCATCT 0: 2
1: 0
2: 1
3: 5
4: 115
Right 1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG 0: 1
1: 1
2: 39
3: 38
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620038 Original CRISPR TTGGATACACACCACCATCT TGG Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
909411963 1:75364608-75364630 TTGGGAAAACACCACCATCCAGG - Intronic
911627733 1:100145174-100145196 TAGGCTACACTACACCATCTAGG + Intronic
915481210 1:156187008-156187030 TTGGATACATACTAACTTCTCGG - Intergenic
918574346 1:186038299-186038321 ATGGATATAAACCACCATGTGGG - Intronic
920362543 1:205429314-205429336 TTTGAAACACACCACCAGCGTGG - Intronic
922012509 1:221604891-221604913 TAGGCTACACTACACCATCTTGG - Intergenic
922288698 1:224192109-224192131 TTGAATACACTCGACCCTCTAGG - Intronic
1068050099 10:51939609-51939631 TTTGAGAAACACCACTATCTTGG + Intronic
1068367447 10:56068795-56068817 AGGGATTCACACTACCATCTGGG + Intergenic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1074679932 10:115895250-115895272 TTCAATACACACGACCACCTTGG - Intronic
1077821253 11:5743635-5743657 TTGGATACACAACAAAATCAAGG + Intronic
1078352549 11:10606440-10606462 TTAGATACACAAAACCAGCTGGG - Intronic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1082044825 11:47716318-47716340 TTGATCACACAGCACCATCTGGG + Intergenic
1086452920 11:86934749-86934771 TTGATTACCCACCACTATCTTGG - Intronic
1088162589 11:106890674-106890696 TTGATTACACACAACCACCTCGG + Intronic
1089729339 11:120511049-120511071 TTGTATACATACCAACATCTTGG - Intergenic
1090050199 11:123371240-123371262 TTGGGTAATCCCCACCATCTTGG + Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1092061358 12:5553543-5553565 TGTGATCCACACCACCAGCTTGG - Intronic
1093930299 12:24949185-24949207 TGGGAGAGACTCCACCATCTGGG - Intronic
1094143036 12:27200124-27200146 TTGGTTACTCACCTCCTTCTTGG + Intergenic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1099948951 12:89278564-89278586 TTGGCTACAGACAATCATCTGGG - Intergenic
1101569535 12:105940478-105940500 TCGAAGACACACCACCATCCTGG + Intergenic
1103503012 12:121419512-121419534 TTGGGTATACACCACCATTTGGG + Intronic
1106257612 13:28035967-28035989 ATGGATACCCATTACCATCTTGG - Exonic
1107215577 13:37914497-37914519 TTGGATTCAGATTACCATCTGGG + Intergenic
1110822901 13:79936921-79936943 TTAGTTAAACACCACAATCTTGG - Intergenic
1113337865 13:109394066-109394088 GTGGATACACACCACCTCCCAGG + Intergenic
1118930646 14:70237045-70237067 TTGCATATACAACACCATGTAGG + Intergenic
1119309605 14:73634699-73634721 TTGGATCCTAGCCACCATCTAGG - Intergenic
1120547940 14:85832904-85832926 TTGGATACACATAAACACCTGGG + Intergenic
1122357176 14:101130808-101130830 TTGGATACTCAGCACCAACCGGG - Intergenic
1127327127 15:57906612-57906634 TTGGAAACAGACCACCAACAGGG - Intergenic
1128285925 15:66436996-66437018 TGGGATCCACATCACTATCTGGG + Intronic
1128975383 15:72149204-72149226 TTGGATATACTCAACCATTTTGG + Intergenic
1132179220 15:99739191-99739213 TTGGATACTGACGGCCATCTGGG - Intergenic
1135340823 16:21646570-21646592 TTGGTTAAACATCACCATGTAGG + Intronic
1138275359 16:55730327-55730349 GTGGATCCACACCATCACCTGGG - Intergenic
1138280601 16:55769957-55769979 GTGGATCCACACCATCACCTGGG - Intergenic
1138287885 16:55823666-55823688 GTGGATCCACACCATCACCTGGG + Exonic
1139216264 16:65126415-65126437 TTGAATCCCCACCACAATCTAGG - Intergenic
1139436600 16:66940217-66940239 GTGGATCCACACCATCACCTGGG - Exonic
1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG + Intronic
1145849261 17:28075732-28075754 TTGGGTACAGACCACTTTCTCGG + Intronic
1147383110 17:40067244-40067266 TGGGACACACCCCACCAGCTAGG + Intronic
1148146520 17:45368549-45368571 ATAGATACACACCACTATATCGG - Intergenic
1148657566 17:49299194-49299216 TTACATACACCCTACCATCTGGG + Intronic
1151381390 17:73728128-73728150 TTAGATGCACAGCACCAGCTGGG - Intergenic
1157792033 18:50541325-50541347 TTGACTCCACACCTCCATCTTGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1168577304 19:57523472-57523494 ATAGCTACATACCACCATCTTGG - Intergenic
925024535 2:597292-597314 CTGGGGACACACCACCATCAAGG + Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
927120276 2:19953446-19953468 TTGGAATCACCCCACCCTCTTGG + Intronic
933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG + Intergenic
933700976 2:85255370-85255392 TTGGAAACACAACAGCATGTAGG - Intronic
937858130 2:126687415-126687437 CTGGATACACAGCATCCTCTGGG - Intronic
939617027 2:144373176-144373198 TTTGATTCTCACAACCATCTTGG + Intergenic
940366372 2:152852658-152852680 TGGGATACACACCCCCACCAGGG - Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
941844003 2:170115506-170115528 TTGGATACATACTAACTTCTTGG + Intergenic
942782217 2:179657663-179657685 TTGGATTCACAACACTTTCTAGG - Intronic
1168970993 20:1930533-1930555 GTGGCTACACAGCCCCATCTAGG + Intronic
1185373177 22:50470165-50470187 TTGGCCCCAAACCACCATCTGGG + Intronic
951662340 3:25082930-25082952 TTGGATATACAGCTCCAGCTTGG + Intergenic
954154987 3:48680460-48680482 CTGGATAAACACCCCCAACTAGG + Intronic
954527089 3:51281679-51281701 TTAGATACACACTATCATCCAGG - Intronic
969026237 4:4174994-4175016 TTGGATGTCCACAACCATCTTGG + Intergenic
972583015 4:40411896-40411918 CTGCAAACACAGCACCATCTTGG - Intergenic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
975220513 4:71808144-71808166 TTGGATACGTACTACCATCCAGG - Intergenic
975972172 4:80052929-80052951 TTGGAAACAATCCATCATCTGGG + Intronic
977167833 4:93723479-93723501 TTAGCTACACACAACCAGCTTGG + Intronic
977836894 4:101655864-101655886 TTAGATACACACCACAATATAGG - Intronic
978024967 4:103862297-103862319 TTGGATACACACCAAGAACTGGG + Intergenic
980993678 4:139760769-139760791 CTGGATACACTCCAGCCTCTTGG - Intronic
981360109 4:143836410-143836432 TTTGTTCCACACCAACATCTGGG - Intergenic
981370881 4:143957478-143957500 TTTGTTCCACACCAACATCTGGG - Intergenic
982045432 4:151440610-151440632 TAGGATAGTCACCACCATCATGG + Intronic
982390508 4:154858257-154858279 TTGAATTCACACCATCTTCTGGG - Intergenic
985077959 4:186236703-186236725 TTAGATACCCACTACCATTTGGG - Intronic
986773054 5:10990635-10990657 TTTAATAAACACCACCATCTGGG - Intronic
990976449 5:61565517-61565539 TTGGATACTCACCACTACCTGGG + Intergenic
992490770 5:77242194-77242216 TTGTAAACACACCACCAGTTTGG - Intronic
996614772 5:125428126-125428148 TTGCATCCATACCACCATATAGG + Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1004454603 6:15780276-15780298 TTGGAAAGACACCATCATCCTGG - Intergenic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1007240841 6:40424170-40424192 TTGGTTCCACTCCACCACCTGGG - Intronic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1012530637 6:100231259-100231281 TTGGTTACACTCCACCAGCCTGG - Intergenic
1018530445 6:164757585-164757607 TATGATACACACCACCACCATGG + Intergenic
1020713197 7:11635341-11635363 TTGGATAAACCAGACCATCTGGG - Intronic
1022578580 7:31524112-31524134 TTGGATACTCACCAATATCAGGG - Intronic
1028712826 7:93929302-93929324 ATTGATACACACAACCAACTTGG - Intergenic
1030146071 7:106357374-106357396 TTGGATACACAACAGCAACTTGG + Intergenic
1031150189 7:118045276-118045298 CTGGAAATATACCACCATCTGGG + Intergenic
1034984428 7:155498940-155498962 TTGTTAACACACCAGCATCTAGG - Intronic
1035279712 7:157769969-157769991 TAGGATACACACCCCGACCTCGG + Intronic
1038692735 8:29777821-29777843 TAGGAAATAGACCACCATCTTGG - Intergenic
1041719311 8:60961842-60961864 CTGTTTGCACACCACCATCTTGG - Intergenic
1041754543 8:61299706-61299728 TTGGATGAACACCACCACATAGG + Exonic
1042086491 8:65115008-65115030 TTGGATTCTCACAACCACCTCGG + Intergenic
1045230559 8:100302499-100302521 TTGGATATACATCTCCACCTAGG - Intronic
1046777705 8:118181253-118181275 TTGGATTCACAATAACATCTTGG + Intergenic
1047933297 8:129751460-129751482 TTGCATAGAAACCACCAACTTGG + Intronic
1047946196 8:129883241-129883263 TAGGAAATACACCAACATCTTGG + Intronic
1050925519 9:11258672-11258694 TTGGGTACATACCAACTTCTTGG - Intergenic
1055927969 9:81530296-81530318 TAGGATAAAGACCATCATCTTGG + Intergenic
1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG + Intergenic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186644368 X:11490635-11490657 TTGAAATCACAGCACCATCTGGG - Intronic
1190250140 X:48717137-48717159 TGGGACACACACCACCAAATAGG + Intergenic
1197893266 X:131286371-131286393 ATGGAGACACGCCAGCATCTTGG + Intronic
1201902548 Y:19058256-19058278 TGGGATACACAACAGCATTTGGG - Intergenic