ID: 1185620041

View in Genome Browser
Species Human (GRCh38)
Location X:1448441-1448463
Sequence TTGGAAAAGCACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 2, 1: 21, 2: 5, 3: 22, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620033_1185620041 21 Left 1185620033 X:1448397-1448419 CCGCCATCTTGGACACGCCACCA 0: 1
1: 0
2: 2
3: 7
4: 110
Right 1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG 0: 2
1: 21
2: 5
3: 22
4: 151
1185620036_1185620041 4 Left 1185620036 X:1448414-1448436 CCACCATCTTGGATACACACCAC 0: 1
1: 3
2: 40
3: 45
4: 164
Right 1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG 0: 2
1: 21
2: 5
3: 22
4: 151
1185620034_1185620041 18 Left 1185620034 X:1448400-1448422 CCATCTTGGACACGCCACCATCT 0: 1
1: 0
2: 3
3: 5
4: 111
Right 1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG 0: 2
1: 21
2: 5
3: 22
4: 151
1185620037_1185620041 1 Left 1185620037 X:1448417-1448439 CCATCTTGGATACACACCACCAT 0: 1
1: 4
2: 46
3: 87
4: 205
Right 1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG 0: 2
1: 21
2: 5
3: 22
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620041 Original CRISPR TTGGAAAAGCACCACCATCT TGG Intronic
902717127 1:18280583-18280605 TAGCAATAGCACCACCATCTAGG - Intronic
904051904 1:27645055-27645077 TTGGCAAAGCACCACCCCCTGGG - Intergenic
905396259 1:37668665-37668687 TTTGGACAGTACCACCATCTTGG + Intergenic
908151446 1:61306706-61306728 CTGAAAAACCTCCACCATCTAGG - Intronic
909411963 1:75364608-75364630 TTGGGAAAACACCACCATCCAGG - Intronic
911477466 1:98391185-98391207 TTGGAATAGCAACACCATTTGGG - Intergenic
915087830 1:153400075-153400097 TTAGAAAAGCACCACAGACTTGG + Intergenic
916793736 1:168146587-168146609 ATGGAAAAGCATTACCATCTGGG - Intergenic
1063286920 10:4698986-4699008 TTGGAAAAGCTCCATGATATTGG + Intergenic
1068050099 10:51939609-51939631 TTTGAGAAACACCACTATCTTGG + Intronic
1072472380 10:95724400-95724422 TTGGAAATGGCCCACGATCTTGG - Intronic
1072649039 10:97279220-97279242 ATTAAAAAGCACCACCAGCTTGG - Intronic
1072675629 10:97463783-97463805 GTTGAACAGCACCACCCTCTGGG - Intronic
1073276543 10:102316538-102316560 TAGGAACAGAACCACCATTTAGG + Intronic
1074437110 10:113443573-113443595 TTGGAAAAGCCCAACACTCTTGG + Intergenic
1074765072 10:116694592-116694614 TTTGAAACGCACCAACATCCTGG + Intronic
1080798410 11:35587294-35587316 TTGGAGAAGCACCAAGATCAGGG - Intergenic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1085218520 11:74852764-74852786 CTGGAAAAGCTGGACCATCTTGG + Intronic
1085403945 11:76250619-76250641 TGGAAAAAGCACCACCCTATTGG - Intergenic
1086951993 11:92899869-92899891 TTGGAAGAGCAGCCCCATGTGGG - Intergenic
1087133103 11:94686020-94686042 TTGGAAAAGCTTCAAAATCTTGG + Intergenic
1088179620 11:107093912-107093934 TTGCAAAAACATCATCATCTTGG + Intergenic
1090050199 11:123371240-123371262 TTGGGTAATCCCCACCATCTTGG + Intergenic
1090453675 11:126828748-126828770 TTTGAAATGCATCCCCATCTAGG + Intronic
1091260158 11:134227395-134227417 CTGGTAAGGTACCACCATCTGGG - Intronic
1097347996 12:58516492-58516514 TTTGAAAAGAATCAGCATCTTGG + Intergenic
1101257015 12:102988701-102988723 TTAGAGAACCAGCACCATCTGGG - Intergenic
1101364740 12:104061408-104061430 TTAGAAAAAAACTACCATCTAGG + Intronic
1101781059 12:107836483-107836505 CTGGAAAAGCTCCAACGTCTTGG - Intergenic
1102231655 12:111266727-111266749 GTAGAAAAGCACCACCAACTGGG - Intronic
1106150494 13:27096298-27096320 TTTGAAAAGCCCCACGTTCTGGG - Intronic
1107990431 13:45814426-45814448 CAGGAAAACCAGCACCATCTCGG + Intronic
1109201196 13:59433668-59433690 TTGCAAAAAGACCATCATCTAGG - Intergenic
1113355457 13:109575932-109575954 TAGGAAAAGCACTACCTTCTGGG - Intergenic
1113916919 13:113879719-113879741 TTGGAAAAGTACCACAAACCGGG + Intergenic
1114973566 14:28065448-28065470 TCCAAAAAGCACCACAATCTGGG - Intergenic
1118502553 14:66375928-66375950 TTGGAAAAGCAGCTACTTCTAGG + Intergenic
1125196941 15:37057967-37057989 TTTGAAAAGAAGCACCATGTTGG - Intronic
1125325850 15:38535284-38535306 TTGGAAGAGCTCTACCATTTTGG + Intronic
1125709314 15:41771959-41771981 GTGGTTAAGCAACACCATCTAGG - Intronic
1128608496 15:69055969-69055991 TTTTAAAAGCAGCACCTTCTGGG - Intronic
1135560195 16:23470250-23470272 ATGGAGAAGCAACAGCATCTGGG - Intronic
1135951471 16:26918302-26918324 TGGGAAAAGCTCCTCCTTCTGGG + Intergenic
1137905701 16:52319844-52319866 TTGGAATTGCAACACCATGTAGG - Intergenic
1143301189 17:5911764-5911786 TTGCCAAAGCACCACCTCCTAGG - Intronic
1144786507 17:17835352-17835374 TTGGAAAAGCCTCACAATCAGGG + Intronic
1153293269 18:3522019-3522041 CTGGAAAAGTCACACCATCTAGG + Intronic
1155649148 18:28119306-28119328 CTGGCAAAGGACCACCATATGGG + Intronic
1157952412 18:52054273-52054295 CTGGTAAAGCACCATCATCAGGG - Intergenic
1160090700 18:75824133-75824155 TTAGAAAATCAACACCATGTTGG + Intergenic
1161749370 19:6083354-6083376 TTGGAACAGCACCAGCACCAGGG - Intronic
1161948526 19:7454091-7454113 TGGGATTAGCAGCACCATCTTGG + Intronic
1163520966 19:17791525-17791547 TTGGCACAGCACCATCAACTGGG + Intergenic
1165079025 19:33297354-33297376 CTGGAATATCAACACCATCTAGG + Intergenic
1167029731 19:46949982-46950004 TAAGAAAAGCACACCCATCTGGG + Intronic
925951372 2:8915323-8915345 TGTGAAAAGCCCCACCAGCTGGG - Intronic
927206474 2:20614314-20614336 TTGGCAAAGCACCATAAACTGGG - Intronic
928825514 2:35415871-35415893 TTTGAAAAGGAGCACCATCAAGG + Intergenic
935157947 2:100500476-100500498 TTGTGAAAGCACCACACTCTGGG + Intergenic
937246215 2:120495701-120495723 TTGTAACAGCACCACAAACTAGG + Intergenic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
943900897 2:193434653-193434675 TTGAAAAACCACCAGCAACTAGG + Intergenic
945973586 2:216253691-216253713 TTGGAAAAACCCAACCACCTTGG + Intergenic
947900104 2:233714129-233714151 TTGTAAAAGCACCATCTTCATGG + Intronic
1170125548 20:12959617-12959639 TGGGGAAAGAAGCACCATCTTGG - Intergenic
1170126229 20:12967332-12967354 TGGGGAAAGAAGCACCATCTTGG - Intergenic
1175599106 20:60258254-60258276 TTGCAAAACCACCAGGATCTTGG + Intergenic
1181235165 22:21444203-21444225 TAGGAAGGGCAGCACCATCTGGG - Intronic
1182878778 22:33715298-33715320 TTGGAAAAAGACCACCCTATTGG - Intronic
950367747 3:12500066-12500088 TGGGGAAAGCAGCACCATCCAGG - Intronic
951712832 3:25602616-25602638 TGGGAAAAGCCACACAATCTGGG - Intronic
952928049 3:38336295-38336317 TTTGAAAAGTACCACCAACTAGG + Intergenic
953591723 3:44263022-44263044 TTGGAGAAGCATCATCATGTAGG + Intronic
954570893 3:51639930-51639952 GTGGAAAAGCAGTACCATCTTGG - Exonic
954678009 3:52326251-52326273 CTGGAAAGGCACCTGCATCTTGG - Exonic
960396222 3:117140964-117140986 TTGAAATAACACCATCATCTTGG + Intergenic
960863920 3:122181403-122181425 GAGGAACAGCCCCACCATCTTGG + Intergenic
960906879 3:122610534-122610556 TTGGAGGAGGACCACTATCTCGG + Exonic
962360156 3:134733830-134733852 TTTGTAAAGTACCACAATCTGGG - Intronic
963283810 3:143413240-143413262 TTGGAAAAGCACACACCTCTGGG - Intronic
964696538 3:159514172-159514194 ATGGAAAACCACCACCGTCATGG + Intronic
965432086 3:168601518-168601540 ATGGAAATGCATCAACATCTGGG - Intergenic
966239488 3:177740536-177740558 TTGGGAAAGCATCAACATTTAGG + Intergenic
969716331 4:8870030-8870052 TTGCAAAAGCCCCCACATCTCGG - Intronic
970207762 4:13672709-13672731 ATGGAAAAGCAGCGCCATCAGGG + Intergenic
970707989 4:18828693-18828715 ATGGAAAAGAATGACCATCTTGG - Intergenic
971569229 4:28188622-28188644 TTGGCAAACCACCACAAACTAGG + Intergenic
971715841 4:30175786-30175808 ATTGGAAAGCCCCACCATCTTGG + Intergenic
973110543 4:46391414-46391436 TTAGAAAAACTGCACCATCTAGG - Intronic
976924097 4:90475644-90475666 CTGTGAAAGCAGCACCATCTAGG + Intronic
977392727 4:96432292-96432314 TTGGAATACCACCACCATATTGG + Intergenic
981403023 4:144336848-144336870 TTGGCAAAGCTCCAACAACTGGG - Intergenic
985611234 5:890720-890742 TTGGAACAGTAGCCCCATCTGGG - Intronic
986773054 5:10990635-10990657 TTTAATAAACACCACCATCTGGG - Intronic
986799708 5:11246612-11246634 ATAGCAAAGCACCACCAACTGGG - Intronic
987144332 5:14977513-14977535 TTGAAAAAGCACCACAAGATAGG - Intergenic
987157461 5:15104442-15104464 TTGGGAATGCAACAGCATCTGGG + Intergenic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
989089805 5:37718370-37718392 TTGGAAAAGATCCACAATGTAGG - Intronic
989416748 5:41186931-41186953 TTGGAAAAGCATTAGCATCTTGG - Intronic
990328278 5:54699348-54699370 ATGGAGAAGAATCACCATCTTGG - Intergenic
990417211 5:55597939-55597961 TTGGGCCAGCCCCACCATCTGGG - Intergenic
992124758 5:73628411-73628433 TTGGAAAAGCCTCACCACTTGGG + Intronic
992293551 5:75304899-75304921 TGAGAGCAGCACCACCATCTTGG + Intergenic
997284358 5:132667776-132667798 TTGGAAAAGTTCCCCCATCCAGG - Intergenic
1003790322 6:9539071-9539093 TTTGAAAACTACCAGCATCTTGG - Intergenic
1004454603 6:15780276-15780298 TTGGAAAGACACCATCATCCTGG - Intergenic
1010801839 6:80186039-80186061 TTTTAAAAGCACCACCTCCTGGG - Intronic
1012397777 6:98819633-98819655 TTCCAACAGCACCACCATCATGG + Intergenic
1015546430 6:134366502-134366524 TTGCAGAAGCTCCACCATTTTGG - Intergenic
1018932906 6:168253553-168253575 CAGGAGAAGCACCATCATCTCGG - Intergenic
1020712982 7:11631804-11631826 TTAGATAAGCAACACCATTTTGG + Intronic
1021763575 7:23924975-23924997 TTGGAAATGCAGCAGCATCTAGG - Intergenic
1024749556 7:52449205-52449227 TTGGTAAATCAGCTCCATCTGGG + Intergenic
1029860451 7:103565750-103565772 TTTGAAAAGCATTACCACCTTGG + Intronic
1031150189 7:118045276-118045298 CTGGAAATATACCACCATCTGGG + Intergenic
1031520415 7:122757973-122757995 TAGGAAAAGCATCATTATCTTGG - Intronic
1031695302 7:124844422-124844444 TTTTAAAAGCATCACCAGCTGGG - Intronic
1035436383 7:158863164-158863186 TTGTAAACGCACCACGATGTGGG - Intronic
1038692735 8:29777821-29777843 TAGGAAATAGACCACCATCTTGG - Intergenic
1040568322 8:48586790-48586812 TTGGAGCAGCACCACCATGGCGG - Intergenic
1043613859 8:82101201-82101223 TTGGAAAAGCATCTTCATCTAGG + Intergenic
1044513677 8:93113660-93113682 TTGGAAAAGCAAAACCACCAAGG + Intergenic
1045702432 8:104882111-104882133 TGACAGAAGCACCACCATCTGGG - Intronic
1047252228 8:123189375-123189397 TTTTAAAACCACCGCCATCTGGG - Intronic
1047946196 8:129883241-129883263 TAGGAAATACACCAACATCTTGG + Intronic
1048749151 8:137650990-137651012 TTGGAAAAGAAACCCCATCCTGG - Intergenic
1050348080 9:4713479-4713501 TTGGAAATGTACTACCAACTTGG - Intronic
1051135800 9:13919137-13919159 TTGGAAAAGCCCCACCATAATGG + Intergenic
1057373100 9:94491713-94491735 TTGGACAAGCAACAACACCTGGG - Intergenic
1058236919 9:102501825-102501847 CTGGTAAAGCATCACCACCTGGG + Intergenic
1058532677 9:105922193-105922215 TGCGAAAAGCTCCACCATCCAGG + Intergenic
1058655934 9:107220573-107220595 TTGGTAGTGCACCACCATATAGG - Intergenic
1060478404 9:124001597-124001619 TTTTAAAAGCAGCAGCATCTGGG - Intergenic
1061524647 9:131149376-131149398 TTGGAAAAGGACTAGCCTCTAGG - Intronic
1061570912 9:131476961-131476983 GTGGAGAAGCAGAACCATCTAGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186177811 X:6943764-6943786 TTGGAAATGCAGCACCATTTAGG - Intergenic
1186463860 X:9769272-9769294 CTGGAAATGCTCCATCATCTTGG + Intronic
1188457489 X:30383173-30383195 GTAAAAAAGCACCACAATCTTGG - Intergenic
1188669997 X:32870582-32870604 ATGGAACAGAACCAACATCTTGG + Intronic
1195010740 X:100730766-100730788 GTAGAAAAGCACCACCAACTTGG - Intronic
1196654390 X:118201798-118201820 TGGGAAAAGGACCATTATCTTGG + Intergenic