ID: 1185620047

View in Genome Browser
Species Human (GRCh38)
Location X:1448495-1448517
Sequence TTGGATAAGCACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620042_1185620047 20 Left 1185620042 X:1448452-1448474 CCACCATCTTGGACACACAACAT No data
Right 1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG No data
1185620043_1185620047 17 Left 1185620043 X:1448455-1448477 CCATCTTGGACACACAACATCTT No data
Right 1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620047 Original CRISPR TTGGATAAGCACCACCATCT TGG Intronic