ID: 1185620050

View in Genome Browser
Species Human (GRCh38)
Location X:1448514-1448536
Sequence TTGGACACATGCCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 2, 2: 19, 3: 25, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620046_1185620050 1 Left 1185620046 X:1448490-1448512 CCATCTTGGATAAGCACCACCAT 0: 16
1: 21
2: 42
3: 78
4: 178
Right 1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG 0: 1
1: 2
2: 19
3: 25
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620050 Original CRISPR TTGGACACATGCCGCCATCT TGG Intronic
900785339 1:4646194-4646216 TTGAACACATGCTGCCTGCTAGG + Intergenic
905538933 1:38744936-38744958 TTGGACACCTGACCCCAGCTGGG + Intergenic
916512684 1:165486684-165486706 TTGGACACTTGCCTCCTCCTGGG + Intergenic
921066990 1:211630461-211630483 TTGGTCACATGCTGGCTTCTTGG - Intergenic
922292469 1:224219964-224219986 CTGGACGAATGCCGCCTTCTGGG - Intergenic
1065191007 10:23209027-23209049 CTGTACACATGCCTTCATCTAGG - Intronic
1070399572 10:76041591-76041613 ATGGACACATCCCTCCCTCTGGG - Intronic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1074523796 10:114247718-114247740 TTGGACTCCTGCCTCCATCATGG - Intronic
1075383146 10:122035065-122035087 TTGGAGACAAGAAGCCATCTTGG + Intronic
1081656617 11:44861679-44861701 TGGGACACATGCGACCACCTGGG - Intronic
1082186819 11:49192527-49192549 TTTGACAAATGCCAACATCTGGG - Intronic
1083812999 11:65116068-65116090 GTGGGCACATGCCCCCACCTGGG - Exonic
1092157884 12:6296166-6296188 TTGGACAGATGTTGCCATCCTGG - Intergenic
1092525218 12:9305682-9305704 TTGCACACATGCCTACAGCTGGG + Intergenic
1092542053 12:9426135-9426157 TTGCACACATGCCTACAGCTGGG - Intergenic
1096820856 12:54233070-54233092 TTGGAAAAATGCAGCCCTCTGGG - Exonic
1111250090 13:85590829-85590851 TTGGACACTTGTCATCATCTGGG - Intergenic
1128994012 15:72283440-72283462 TTGGACACATGCCCACCACTAGG - Intronic
1131708922 15:95031608-95031630 TTGGACACATGCCACAACGTGGG + Intergenic
1137722576 16:50636135-50636157 TTGGCCACGTGACCCCATCTGGG - Exonic
1140039380 16:71395933-71395955 TTGAACATCTGCCACCATCTAGG + Intergenic
1141866123 16:86751283-86751305 TTGGCCACATGTTGGCATCTGGG - Intergenic
1144492448 17:15725389-15725411 TTGGCCACAGGCGGGCATCTGGG - Intergenic
1144908026 17:18653798-18653820 TTGGCCACAGGCGGGCATCTGGG + Intronic
1145057733 17:19714387-19714409 TTCGACACATGCCTGCATGTAGG + Intronic
1148028103 17:44602104-44602126 GTGGACACATGCAGACATCCTGG - Intergenic
1149784824 17:59425888-59425910 TTAGACACATGCTGTCATCTGGG - Intergenic
1151162569 17:72177477-72177499 TTAGACACATGCGGCATTCTGGG - Intergenic
1156630492 18:38962590-38962612 TTGGGCAAATGCCTCCATTTCGG - Intergenic
1156920257 18:42513804-42513826 TTGGAGCCATGCCACCATTTTGG + Intergenic
1160622082 18:80178778-80178800 ATGGACACATGCCGACAGCATGG + Intronic
1165727414 19:38122847-38122869 TTGGTCACATGTCGCCTTGTCGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
931289383 2:60858957-60858979 TTGGTCACATGGCTGCATCTTGG - Intergenic
931652874 2:64484257-64484279 TGGGTCACATGGCTCCATCTTGG - Intergenic
932294739 2:70615045-70615067 TAGGACATATGTAGCCATCTGGG - Intronic
933072402 2:77876279-77876301 TTGGACACTTGCCTCCGTTTTGG + Intergenic
933090108 2:78108145-78108167 CTGGGCACCTGCCTCCATCTAGG + Intergenic
940860246 2:158763796-158763818 TTTGACACATGCCGCAACATGGG + Intergenic
942577299 2:177377706-177377728 TTGCACACATAACCCCATCTGGG + Intronic
945170743 2:206992153-206992175 ATGGACACCTGCCCCAATCTGGG - Intergenic
948388784 2:237597770-237597792 TTGGACACAGGCCTCCATCCAGG + Intronic
948572816 2:238928007-238928029 CTGGACACATGCCTCCTCCTGGG + Intergenic
1169281781 20:4273978-4274000 TGGAACACCTGCAGCCATCTTGG + Intergenic
1173224071 20:41151707-41151729 TTGGGCATATGCAGCCAGCTTGG + Intronic
1176079657 20:63265874-63265896 GTGGACACATGACCCCAGCTAGG + Intronic
1177396253 21:20539197-20539219 TTGGAAACTTGCCGCTATCAAGG - Intergenic
1179501706 21:41813290-41813312 TGGGCCACATGCCCTCATCTGGG - Intronic
968973030 4:3805999-3806021 TTGGAGCCCTGCCGCCATCCCGG + Intergenic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
976342449 4:83960393-83960415 TTGGACACTTCCCATCATCTTGG + Intergenic
976493188 4:85695300-85695322 TTGGGCACATGCCATGATCTAGG - Intronic
979941622 4:126770663-126770685 CTGGACTACTGCCGCCATCTTGG + Intergenic
986473594 5:8100582-8100604 TTTGACAAATGCCTGCATCTGGG - Intergenic
1003221294 6:4163231-4163253 ATGGCCACATGCTTCCATCTGGG - Intergenic
1006076392 6:31535250-31535272 TTGGGCACAAGCCGCCTTCTTGG + Intronic
1009368792 6:62876892-62876914 TTGTACACATGCTGCGATATTGG - Intergenic
1016472907 6:144393604-144393626 CATGACACAGGCCGCCATCTTGG - Intronic
1016624145 6:146146137-146146159 TTTGAGACGTGGCGCCATCTCGG + Intronic
1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG + Intronic
1032388723 7:131541906-131541928 TTGGACACCTGGCTCCAACTGGG - Intronic
1035409772 7:158630123-158630145 CTGGACACATGCCCACATGTAGG + Intergenic
1037024348 8:14014638-14014660 TTGGACATTTTCAGCCATCTGGG - Intergenic
1038383797 8:27121707-27121729 TTGGACTGATGCCTCCCTCTTGG - Intergenic
1042065406 8:64869536-64869558 TTGGACACATAACTCCACCTGGG + Intergenic
1043483844 8:80679410-80679432 TTGGACCCATGCAGCAATCTGGG - Intronic
1047404453 8:124573546-124573568 TTGAACACCTGCCGCCTTCCAGG - Intronic
1049365341 8:142234315-142234337 TTGGGGTCATGGCGCCATCTTGG - Intronic
1057070423 9:92094149-92094171 TTGGTCAGATGCATCCATCTTGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619872 X:1447289-1447311 TTGGACCCATTACACCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1202115286 Y:21465776-21465798 TCTGACCCATGCCGACATCTGGG + Intergenic