ID: 1185620053

View in Genome Browser
Species Human (GRCh38)
Location X:1448533-1448555
Sequence TTGGACACACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620048_1185620053 4 Left 1185620048 X:1448506-1448528 CCACCATCTTGGACACATGCCGC No data
Right 1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG No data
1185620046_1185620053 20 Left 1185620046 X:1448490-1448512 CCATCTTGGATAAGCACCACCAT No data
Right 1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG No data
1185620049_1185620053 1 Left 1185620049 X:1448509-1448531 CCATCTTGGACACATGCCGCCAT No data
Right 1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620053 Original CRISPR TTGGACACACACTGCCATCT TGG Intronic