ID: 1185620060

View in Genome Browser
Species Human (GRCh38)
Location X:1448582-1448604
Sequence ATGGCCGTGTGTGTCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620060_1185620066 20 Left 1185620060 X:1448582-1448604 CCATCTTGGACACACACGGCCAT No data
Right 1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG No data
1185620060_1185620063 1 Left 1185620060 X:1448582-1448604 CCATCTTGGACACACACGGCCAT No data
Right 1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620060 Original CRISPR ATGGCCGTGTGTGTCCAAGA TGG (reversed) Intronic