ID: 1185620061

View in Genome Browser
Species Human (GRCh38)
Location X:1448587-1448609
Sequence TTGGACACACACGGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 2, 1: 26, 2: 18, 3: 48, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620054_1185620061 17 Left 1185620054 X:1448547-1448569 CCATCTTGGATAAGCACCACCAT 0: 16
1: 21
2: 42
3: 78
4: 178
Right 1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG 0: 2
1: 26
2: 18
3: 48
4: 106
1185620056_1185620061 1 Left 1185620056 X:1448563-1448585 CCACCATCTTGGACACACACCAT 0: 10
1: 8
2: 18
3: 47
4: 190
Right 1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG 0: 2
1: 26
2: 18
3: 48
4: 106
1185620057_1185620061 -2 Left 1185620057 X:1448566-1448588 CCATCTTGGACACACACCATCTT 0: 8
1: 9
2: 11
3: 58
4: 284
Right 1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG 0: 2
1: 26
2: 18
3: 48
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620061 Original CRISPR TTGGACACACACGGCCATCT TGG Intronic
901383915 1:8894059-8894081 TTTGACACACATGGCCACCTTGG + Intergenic
903876254 1:26475428-26475450 TTTGACACACATGGCCACCTTGG + Exonic
905451340 1:38058771-38058793 TTGGACACACAAGGACACCTTGG - Intergenic
906137567 1:43510266-43510288 TTGGACATCCTCTGCCATCTTGG + Intergenic
908647947 1:66300036-66300058 TTGCACAAACACAGACATCTAGG + Intronic
909495976 1:76279163-76279185 TTGGACACACACAGCCAGGCAGG + Intronic
915336937 1:155149407-155149429 TTTGACACACATGGCCACCTTGG + Intergenic
920490855 1:206413843-206413865 TGGTACACACAGGACCATCTGGG + Intronic
922952544 1:229571084-229571106 TTTGACACACATGGCCACCTTGG + Intergenic
1063377268 10:5561810-5561832 TTGGAGTCACTCTGCCATCTTGG - Intergenic
1063685486 10:8233442-8233464 CTGGGCACACATAGCCATCTAGG + Intergenic
1072265337 10:93721773-93721795 CTGGCCAAACATGGCCATCTTGG + Intergenic
1072265505 10:93722951-93722973 CTGGTCAAACATGGCCATCTTGG - Intergenic
1073583401 10:104687189-104687211 TTGGAAAGACAAGGCCACCTTGG - Intronic
1075192984 10:120328571-120328593 TTGGACATAAACAGCAATCTAGG - Intergenic
1078693898 11:13610120-13610142 TTTGAGACACATGGCCACCTTGG - Intergenic
1081059941 11:38461876-38461898 TTGGAAACGCACACCCATCTGGG - Intergenic
1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG + Intergenic
1085074736 11:73580791-73580813 TTTGACACACATGGCCACCTTGG + Intronic
1091394769 12:147249-147271 TTGGTCACAAACGGCCCTCCTGG - Intronic
1094366545 12:29688912-29688934 TTGGTCACACAGGGCCACCAGGG - Intronic
1095230717 12:39735952-39735974 TTGGAGAAACACTGCCAGCTTGG + Intronic
1095633719 12:44406921-44406943 CTGGACACAGAGGGCCCTCTAGG - Intergenic
1098979110 12:76935937-76935959 TTGGCCAGACAAGACCATCTAGG - Intergenic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1105026164 12:132850552-132850574 TGGGACACACCCGGTGATCTGGG - Intronic
1114511289 14:23263609-23263631 TTTGACACACATGGCCACCTTGG - Intronic
1114756551 14:25266767-25266789 TCTGACACACATGGCCACCTTGG - Intergenic
1117413390 14:55471003-55471025 TTGGACACACAGACCAATCTTGG + Intergenic
1117941524 14:60971958-60971980 TTTGACACACATGGCCACCTTGG - Exonic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1119706861 14:76788477-76788499 TTGGAGGCACAGGGCCAGCTGGG + Exonic
1120132416 14:80823064-80823086 GTTGACACACATGGCCACCTTGG + Intronic
1122210931 14:100173553-100173575 CTTGCCACACACGGCCACCTGGG - Intergenic
1124445858 15:29731262-29731284 TTTGACACACATGGCCACCTTGG + Intronic
1126154836 15:45556210-45556232 TTTGATACACATGGCCACCTTGG + Intergenic
1129419937 15:75416640-75416662 TTTAACACACATGGCCACCTTGG + Intronic
1132179220 15:99739191-99739213 TTGGATACTGACGGCCATCTGGG - Intergenic
1132698950 16:1214127-1214149 TGGGACACTCACGGCCAGGTTGG - Intronic
1135858295 16:26032239-26032261 TTTGACACACATGGCCACCTTGG - Intronic
1137062329 16:35802612-35802634 TTTGACACACATGGCCACCTTGG - Intergenic
1141883950 16:86879104-86879126 TGGGACACTCACGGCCATGGGGG + Intergenic
1144140460 17:12342498-12342520 TTGGCCACACACGCCCTTATGGG - Intergenic
1144492448 17:15725389-15725411 TTGGCCACAGGCGGGCATCTGGG - Intergenic
1144908026 17:18653798-18653820 TTGGCCACAGGCGGGCATCTGGG + Intronic
1147420746 17:40321120-40321142 CTGGACACACACGGAGATCCAGG - Intronic
1147753567 17:42753233-42753255 TTTGACACACATGGCCACCTTGG - Intergenic
1148857650 17:50587533-50587555 TTGGACAGACCTGGCTATCTGGG + Intronic
1149896830 17:60434871-60434893 TTTGATACACATGGCCACCTTGG - Intergenic
1150171824 17:63004404-63004426 TTTGACACACATAGCCACCTTGG - Intergenic
1153837498 18:8977094-8977116 TTGGCCACACCCGGCCACCTTGG - Intergenic
1154352799 18:13600619-13600641 TTGGTCACACATGGTCTTCTTGG - Intronic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1159611718 18:70533055-70533077 TTGGTAACACACGCCCATTTGGG - Intergenic
1160802878 19:978527-978549 TTGGCCACACAGGGCCAGCCGGG + Intergenic
1161312976 19:3604861-3604883 TTGGACCCACAGGGCCCTTTTGG + Intronic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926320017 2:11743185-11743207 CTGGACACACAGGAGCATCTTGG - Intronic
927588434 2:24331553-24331575 TTTAACACACATGGCCACCTTGG + Intronic
928048180 2:27960328-27960350 TTGCACACAAAGGGCAATCTTGG - Intronic
930233981 2:48871573-48871595 TTCAACACATAAGGCCATCTGGG + Intergenic
932117423 2:69065856-69065878 TTGGAGCCATAAGGCCATCTGGG + Intronic
933974991 2:87502226-87502248 TTGAACACACACGTTCAGCTGGG + Intergenic
935168454 2:100590445-100590467 TTTGACACACATGACCACCTTGG - Intergenic
936318835 2:111448587-111448609 TTGAACACACACGTTCAGCTGGG - Intergenic
936492082 2:112980868-112980890 TTTGACACACATGGCCACCTTGG - Intronic
937738368 2:125318943-125318965 CTGGACCCACAGGGCCAGCTTGG + Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
943654064 2:190488658-190488680 AGTGACACACGCGGCCATCTGGG + Exonic
947434239 2:230059182-230059204 GAGGACACCCAGGGCCATCTGGG + Exonic
1169134041 20:3185650-3185672 AAGGATACACAAGGCCATCTAGG + Intergenic
1176267430 20:64217555-64217577 TTGGACACACACGCCCGTAACGG - Intronic
1180720824 22:17907157-17907179 AGGGAGACACAAGGCCATCTCGG + Intronic
1181788170 22:25242684-25242706 TTGGACAGAAACTGCTATCTCGG - Intergenic
1181789192 22:25250247-25250269 TTGGAGACAAATGGCCATCAAGG - Intergenic
949771824 3:7587544-7587566 TAGGGCACACAGGGCCTTCTGGG - Intronic
950778962 3:15374767-15374789 TTTGACACACATGGCCACCTTGG - Intergenic
965658747 3:171018415-171018437 TGGGAGACACAAGGCCATCCTGG - Intronic
969590304 4:8118229-8118251 TTGCACACTGACTGCCATCTGGG + Intronic
969733670 4:8972473-8972495 ATGCACACCCACGGCTATCTTGG + Intergenic
976671254 4:87656620-87656642 TGGAACATACACAGCCATCTTGG - Intronic
982448220 4:155519995-155520017 TTGCACAAACAGTGCCATCTAGG - Intergenic
988995060 5:36706807-36706829 TTGGAGAACCACTGCCATCTGGG - Intergenic
992101367 5:73410702-73410724 TTTGACACACATGGCCACCTTGG + Intergenic
992381455 5:76241721-76241743 TTTGACACACATGGCCACCTTGG - Intronic
995819840 5:116217731-116217753 TTTGACACATATGGCCACCTTGG - Intronic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
1000015228 5:157269808-157269830 TTGTACAGACAAGGCCATCCAGG - Intronic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1002706325 5:181162801-181162823 GTGGACACACAGGGCCATCACGG + Intergenic
1007200344 6:40102770-40102792 GTGAACACACAGGGCCTTCTAGG + Intergenic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1007697736 6:43744396-43744418 GTGCACACACACAGCCAACTGGG - Intergenic
1010727702 6:79354157-79354179 TTTGACACACATGGCCACCTTGG - Intergenic
1011614895 6:89188839-89188861 TTGCACACACACAGACATCCTGG - Intronic
1012914587 6:105155890-105155912 TTGGCCACACATTGCCATCATGG - Intergenic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1014923896 6:127247689-127247711 ATGGACAGTCACGGCCAGCTGGG + Intergenic
1015711469 6:136146083-136146105 TTGGTCACTCACTGCCATCAGGG + Intronic
1017137882 6:151164277-151164299 TTGGACTCCCACGGAAATCTTGG - Intergenic
1031350237 7:120722212-120722234 TTGGAAGCACAGGGCCAGCTTGG - Intronic
1031453954 7:121956776-121956798 TTTGACATACATGGCCACCTTGG - Intronic
1038102789 8:24397751-24397773 TATGAAACACACGGCCCTCTCGG + Intronic
1042182303 8:66103370-66103392 TTGGAAACACAAGGTCATCCTGG - Intergenic
1042458393 8:69032343-69032365 TTGGACACACACGTGCACATAGG - Intergenic
1043252926 8:78098456-78098478 TTGGACCCTCACTGACATCTAGG + Intergenic
1044423525 8:92025580-92025602 TGGGACAAACCCGGCCAGCTGGG - Intronic
1044824658 8:96184534-96184556 TTGGACACACACTGAGTTCTAGG - Intergenic
1049270193 8:141691458-141691480 ATGGCCACCCACGGCCAACTGGG - Intergenic
1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG + Intergenic
1054813304 9:69451814-69451836 TTGTACAAACACTGCAATCTAGG - Intronic
1056180665 9:84079297-84079319 TTTGACACACATGGCCACCTTGG + Intergenic
1057247808 9:93472511-93472533 TTGGACACACAAGGCCAGTTTGG + Intronic
1058683007 9:107456594-107456616 TTTGACACACTTGGCCACCTTGG - Intergenic
1059876465 9:118640957-118640979 TTGGAGAGACAAGGCCAACTTGG + Intergenic
1061572451 9:131486107-131486129 TTGCAAACACATGGCCATCCAGG - Exonic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619216 X:1443112-1443134 GTGGACACACACCGCCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619235 X:1443245-1443267 GTGGACACACGCCGCCGTCTTGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619271 X:1443473-1443495 GTGGACACATGCCGCCATCTTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619292 X:1443613-1443635 GTGGACAGACACCGCCATCGTGG + Intronic
1185619295 X:1443632-1443654 GTGGACAGACACCGCCATCATGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619935 X:1447708-1447730 TTGGACAAGCACTGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620094 X:1448809-1448831 TTGGACAAGCACTGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186938163 X:14474081-14474103 TTGTACACACACAGCCACTTAGG - Intergenic
1187938005 X:24354518-24354540 TTTGACACACATGGCCACCTTGG + Intergenic
1192130379 X:68544060-68544082 TTGGCCTCTCACAGCCATCTTGG - Intergenic
1195506537 X:105664610-105664632 TTGAACTCACAGGGGCATCTGGG - Intronic
1199212153 X:145225364-145225386 TTAGAAACACATGGCCATATGGG - Intergenic
1199999595 X:153051854-153051876 TTTGACACACATGGCCACCTTGG - Intergenic