ID: 1185620061

View in Genome Browser
Species Human (GRCh38)
Location X:1448587-1448609
Sequence TTGGACACACACGGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620056_1185620061 1 Left 1185620056 X:1448563-1448585 CCACCATCTTGGACACACACCAT No data
Right 1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG No data
1185620057_1185620061 -2 Left 1185620057 X:1448566-1448588 CCATCTTGGACACACACCATCTT No data
Right 1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG No data
1185620054_1185620061 17 Left 1185620054 X:1448547-1448569 CCATCTTGGATAAGCACCACCAT No data
Right 1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620061 Original CRISPR TTGGACACACACGGCCATCT TGG Intronic