ID: 1185620066

View in Genome Browser
Species Human (GRCh38)
Location X:1448625-1448647
Sequence TTGGACACACACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620062_1185620066 1 Left 1185620062 X:1448601-1448623 CCATCTTGGATAAGCACCACCAT No data
Right 1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG No data
1185620060_1185620066 20 Left 1185620060 X:1448582-1448604 CCATCTTGGACACACACGGCCAT No data
Right 1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620066 Original CRISPR TTGGACACACACCGCCATCT TGG Intronic