ID: 1185620066 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:1448625-1448647 |
| Sequence | TTGGACACACACCGCCATCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185620060_1185620066 | 20 | Left | 1185620060 | X:1448582-1448604 | CCATCTTGGACACACACGGCCAT | No data | ||
| Right | 1185620066 | X:1448625-1448647 | TTGGACACACACCGCCATCTTGG | No data | ||||
| 1185620062_1185620066 | 1 | Left | 1185620062 | X:1448601-1448623 | CCATCTTGGATAAGCACCACCAT | No data | ||
| Right | 1185620066 | X:1448625-1448647 | TTGGACACACACCGCCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185620066 | Original CRISPR | TTGGACACACACCGCCATCT TGG | Intronic | ||