ID: 1185620081

View in Genome Browser
Species Human (GRCh38)
Location X:1448728-1448750
Sequence ATGGTGGTGTGTGTCCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620081_1185620088 20 Left 1185620081 X:1448728-1448750 CCATCTGGGACACACACCACCAT No data
Right 1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG No data
1185620081_1185620085 1 Left 1185620081 X:1448728-1448750 CCATCTGGGACACACACCACCAT No data
Right 1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620081 Original CRISPR ATGGTGGTGTGTGTCCCAGA TGG (reversed) Intronic