ID: 1185620082

View in Genome Browser
Species Human (GRCh38)
Location X:1448733-1448755
Sequence TGGGACACACACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 27, 3: 46, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620078_1185620082 -2 Left 1185620078 X:1448712-1448734 CCATCTTGGACACACACCATCTG 0: 3
1: 8
2: 7
3: 28
4: 247
Right 1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG 0: 1
1: 0
2: 27
3: 46
4: 185
1185620077_1185620082 1 Left 1185620077 X:1448709-1448731 CCACCATCTTGGACACACACCAT 0: 10
1: 8
2: 18
3: 47
4: 190
Right 1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG 0: 1
1: 0
2: 27
3: 46
4: 185
1185620075_1185620082 17 Left 1185620075 X:1448693-1448715 CCATCTTGGAGAAGCACCACCAT 0: 3
1: 33
2: 43
3: 80
4: 234
Right 1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG 0: 1
1: 0
2: 27
3: 46
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620082 Original CRISPR TGGGACACACACCACCATCT TGG Intronic
901678840 1:10901717-10901739 TGGGCCAGACCCCACCACCTCGG - Intergenic
902269092 1:15290219-15290241 TGGGACACACACAACCTTCAGGG + Intronic
906295209 1:44645322-44645344 TGAGTCAGTCACCACCATCTAGG - Intronic
906379709 1:45324772-45324794 TAGGCCACACAACACCTTCTGGG + Intergenic
915535261 1:156531501-156531523 TCTGACACCCACCACCCTCTTGG + Intronic
915912219 1:159922420-159922442 AGGCACACACACCATCAGCTTGG + Intronic
916327841 1:163582884-163582906 TGGGACAAACACCACTCTCAAGG - Intergenic
917855375 1:179095124-179095146 GGGGACATACACCATCATCTGGG - Exonic
920294827 1:204949639-204949661 TGGTTCACACACCACCAGCATGG + Intronic
920490855 1:206413843-206413865 TGGTACACACAGGACCATCTGGG + Intronic
922291600 1:224213202-224213224 TGGGAGACAGCCCACCAGCTGGG + Intergenic
1064467317 10:15597234-15597256 AAGGTCACACACCACCATCCTGG + Exonic
1067249343 10:44574120-44574142 TGGGAAACACCACAGCATCTGGG + Intergenic
1067292708 10:44956020-44956042 TGGTACAGACACCACCACATTGG + Intergenic
1067756501 10:49009740-49009762 TGAGGCTGACACCACCATCTGGG - Intergenic
1068367447 10:56068795-56068817 AGGGATTCACACTACCATCTGGG + Intergenic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1070416135 10:76191304-76191326 GGGGACACTCAACACCATCCAGG - Intronic
1070442481 10:76460464-76460486 TGGAACACAGATCTCCATCTTGG - Intronic
1071416162 10:85443989-85444011 AGGGACTAACATCACCATCTTGG - Intergenic
1072956772 10:99893795-99893817 TGGGAGATACACTAGCATCTTGG - Intronic
1075135887 10:119785831-119785853 AGGGTCTCACTCCACCATCTAGG - Intronic
1078037696 11:7824523-7824545 TGGGAGACCCACAACAATCTGGG - Intergenic
1081085299 11:38792108-38792130 AGGGACAGACAACACCATCTAGG + Intergenic
1081656617 11:44861679-44861701 TGGGACACATGCGACCACCTGGG - Intronic
1081840516 11:46197815-46197837 TGGGTCCCACACCACACTCTGGG - Intergenic
1082044825 11:47716318-47716340 TTGATCACACAGCACCATCTGGG + Intergenic
1083192512 11:61062443-61062465 TGGGCCACACACCCACATGTTGG - Intergenic
1087468743 11:98545380-98545402 TGGAACACACACCCCCATTAGGG + Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1092061358 12:5553543-5553565 TGTGATCCACACCACCAGCTTGG - Intronic
1093930299 12:24949185-24949207 TGGGAGAGACTCCACCATCTGGG - Intronic
1095128161 12:38506847-38506869 TGGGAAACACAACTCCATATAGG - Intergenic
1097189849 12:57214442-57214464 TGGGACACAGACCTCCTACTCGG - Intergenic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1101569535 12:105940478-105940500 TCGAAGACACACCACCATCCTGG + Intergenic
1102811458 12:115827696-115827718 TGTGTCACACACCACCATCACGG + Intergenic
1106599265 13:31173904-31173926 AGCGACACAAAACACCATCTTGG - Intergenic
1108493696 13:51004836-51004858 TGGGACACACACGACTTTTTTGG - Intergenic
1108498829 13:51050244-51050266 TGGGGCACTCTCCACCATGTTGG + Intergenic
1108764299 13:53607745-53607767 TGTGTCACACTACACCATCTTGG + Intergenic
1111827994 13:93293122-93293144 ACAGGCACACACCACCATCTCGG + Intronic
1115153781 14:30315256-30315278 TGGGCCCCACAGCAGCATCTGGG - Intergenic
1121267787 14:92615570-92615592 TGGGCCACACCCCTCCCTCTGGG - Intronic
1122481833 14:102052273-102052295 ACAGACACACACCACCATGTCGG + Intergenic
1126723439 15:51606630-51606652 TGGGTAAGATACCACCATCTTGG + Intronic
1126728916 15:51661634-51661656 TGGGAAACACAACATCCTCTAGG + Intergenic
1127545805 15:59993758-59993780 TGGGAAACAGAACACCTTCTGGG - Intergenic
1127958581 15:63873882-63873904 TGGTACAGACACCCCCAACTAGG + Intergenic
1128285925 15:66436996-66437018 TGGGATCCACATCACTATCTGGG + Intronic
1131046852 15:89321991-89322013 GGGCAGCCACACCACCATCTGGG + Exonic
1132857719 16:2054406-2054428 TGGGAGACACATCACCTACTTGG + Exonic
1139462134 16:67130779-67130801 TGGAGCACACACCACCCTATAGG - Intronic
1141789460 16:86224508-86224530 TGTGACAGACACCCCCATTTTGG - Intergenic
1143024396 17:3932903-3932925 AGGGACACACACCTCCCACTCGG + Intronic
1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG + Intronic
1143981788 17:10876263-10876285 TGGTGCACAGACCCCCATCTTGG - Intergenic
1144476765 17:15595479-15595501 TGGGGCAGACACTACCTTCTTGG + Intronic
1144921478 17:18767870-18767892 TGGGACAGACACTACCTTCTTGG - Intronic
1145822462 17:27849861-27849883 TGGTGCACACACCATCACCTGGG - Intronic
1146122535 17:30208173-30208195 AGAGACACACACCCCCTTCTTGG + Intronic
1147383110 17:40067244-40067266 TGGGACACACCCCACCAGCTAGG + Intronic
1147515585 17:41114584-41114606 TGGGCCCCACAGCAGCATCTAGG - Intergenic
1148385965 17:47235305-47235327 AGAGACACACACCACCACATTGG - Intergenic
1149237326 17:54607497-54607519 TGGGCCCCACAGCAGCATCTCGG - Intergenic
1152912479 17:83013268-83013290 TGAGACACAGGCCACCTTCTCGG - Intronic
1153528742 18:6022002-6022024 TGAGACACAGACCAACATTTGGG - Intronic
1154637500 18:16876670-16876692 TGAGACACCCACCACCATCCAGG - Intergenic
1157985838 18:52436494-52436516 TGGGACCCACCTCACTATCTCGG + Intronic
1160020061 18:75173309-75173331 TGGTTCACACACCAGCATCCAGG - Intergenic
1160273700 18:77410847-77410869 TGTGACAAACACCACAACCTGGG + Intergenic
1161045160 19:2130667-2130689 GGGGCCACAGACCAGCATCTTGG + Intronic
1164052503 19:21595255-21595277 TGGGAGACACACCACCTGGTTGG - Intergenic
1165077000 19:33285251-33285273 TGGGACAGAAACCAGCATCCCGG - Intergenic
1166251687 19:41575876-41575898 TGTGACACACAAAACCAGCTGGG - Intronic
1168323631 19:55525789-55525811 AGGGACCCCCGCCACCATCTTGG + Intergenic
925008407 2:464381-464403 GGGGACACATCCCAGCATCTGGG - Intergenic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926141856 2:10372668-10372690 TGGGACCCACGCCACCCTCCGGG - Intronic
926426752 2:12745223-12745245 CAGGTCACACTCCACCATCTGGG - Intergenic
929903390 2:46025297-46025319 TGGAACACACACCCCCAGCCAGG + Intronic
932653139 2:73581689-73581711 AGGGACACACAACTCCACCTGGG - Intronic
932706159 2:74026413-74026435 TGGGACACACACCTCTGACTGGG - Intronic
933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG + Intergenic
935746835 2:106196215-106196237 TGGGACACCAACCGCCTTCTGGG - Intergenic
936063642 2:109314149-109314171 CGGGACACAGACCACGACCTTGG - Intronic
936093649 2:109516209-109516231 TGGGCCACACATCACCTGCTCGG - Intergenic
937477181 2:122226135-122226157 AGGGACACACACCACTCTCTCGG + Intergenic
940366372 2:152852658-152852680 TGGGATACACACCCCCACCAGGG - Intergenic
940610196 2:155980393-155980415 TGGGAGACACACATCCATCTTGG + Intergenic
940656608 2:156494712-156494734 TGGGAAAAACACCACCATCATGG + Intronic
940830836 2:158463567-158463589 TGGGACACACACCTGCATAGTGG - Intronic
944663292 2:201938918-201938940 TGGAACAGAGACCGCCATCTCGG + Intergenic
1169692711 20:8350262-8350284 TGGGGCAAACACCACACTCTGGG - Intronic
1170052339 20:12159575-12159597 TGGGACACACAGAAACAGCTGGG - Intergenic
1173819055 20:46009102-46009124 TGGGACACTCAACACCCTCACGG - Intronic
1174228750 20:49026496-49026518 TGAGAATCCCACCACCATCTTGG - Intronic
1174399911 20:50270368-50270390 TGGGACACCCACCGTCATCCAGG - Intergenic
1176686510 21:9852662-9852684 TGAGACACCCACCACCATCCAGG - Intergenic
1179360723 21:40705838-40705860 TGGCTCCCACACCTCCATCTCGG + Intronic
1182281702 22:29221142-29221164 TGGGCCACTTCCCACCATCTGGG - Intronic
1182452436 22:30429432-30429454 TGGGGCTGACACCACCATCTTGG - Intergenic
1185373177 22:50470165-50470187 TTGGCCCCAAACCACCATCTGGG + Intronic
952552462 3:34494956-34494978 TGAGACACAGTCCACCTTCTGGG + Intergenic
953371947 3:42396281-42396303 TGGGACCCACACCATCATGGGGG - Intergenic
953608025 3:44424534-44424556 TGGGACACACAGCAGCCGCTGGG - Intergenic
956974052 3:74559580-74559602 TGAGACACACACAACCAACTTGG + Intergenic
958803718 3:98784538-98784560 TGTGAAACACACCTCCATATAGG - Intronic
961056258 3:123791104-123791126 TGGGACACACCCCTCCCTCCAGG - Intronic
961357090 3:126346083-126346105 TGTGACACACACACCCATCCAGG - Intronic
961495285 3:127287148-127287170 TGGGACCACCACCTCCATCTGGG - Intergenic
964601543 3:158506336-158506358 TGTGACACATACTCCCATCTCGG - Intronic
966750119 3:183313876-183313898 TGGGAGCCCCACCACCACCTTGG + Intronic
968957587 4:3727091-3727113 GGGGACACCCACCAGCATCCCGG - Intergenic
969213987 4:5708632-5708654 TGGAACAAACACCCGCATCTGGG + Intronic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
976671254 4:87656620-87656642 TGGAACATACACAGCCATCTTGG - Intronic
979398756 4:120221892-120221914 TGGGAAACTCACCACCAATTTGG - Intergenic
980349958 4:131671131-131671153 TGAGACACCCACCACCATCCAGG - Intergenic
980496604 4:133592694-133592716 TGGGCCCCACAGCAGCATCTTGG - Intergenic
991012150 5:61895039-61895061 TGGGACACATACCTACACCTTGG - Intergenic
991374114 5:65948203-65948225 TGGGACACAGAGCAACATCCTGG - Intronic
991767688 5:70004957-70004979 TGGAACACTCACCGCCATCACGG + Intergenic
991846922 5:70880033-70880055 TGGAACACTCACCGCCATCACGG + Intergenic
992851919 5:80819019-80819041 TGGAACACAAAGCACTATCTAGG - Intronic
998980806 5:147699948-147699970 TAGGTCACACACCACCATGAAGG - Intronic
1001669834 5:173464353-173464375 TGGCAACCACACCACCATCAAGG + Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1007394772 6:41571147-41571169 TCGGTCACCCACCACCACCTTGG + Intronic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1011034671 6:82960001-82960023 GGGGACATGCACCATCATCTTGG + Intronic
1014418771 6:121215352-121215374 TGGGACTCCCACCAGCATCATGG + Intronic
1017333391 6:153225860-153225882 TGTGCCATACACCACCATCCTGG + Intergenic
1017812878 6:157996758-157996780 TGGCACCCACCCCACCCTCTTGG + Intronic
1018856487 6:167678807-167678829 GGGGACACGCAGCACCAACTCGG - Intergenic
1018995908 6:168710240-168710262 TGGGACACACAGCACCTGCGTGG - Intergenic
1024213494 7:47227397-47227419 GGGGTCCCACAGCACCATCTTGG - Intergenic
1027397934 7:77775476-77775498 TGTGAAACACAGCACGATCTCGG - Intronic
1027592348 7:80133536-80133558 TGGGAGTCACACCACCTGCTGGG - Intergenic
1030389438 7:108907602-108907624 TGGCTCACAAAACACCATCTAGG - Intergenic
1035218512 7:157390121-157390143 TGGGACAGCAACCACCATCTGGG - Intronic
1037642455 8:20759195-20759217 TGGAACACAGACCACATTCTGGG - Intergenic
1038692735 8:29777821-29777843 TAGGAAATAGACCACCATCTTGG - Intergenic
1038715947 8:29991316-29991338 TGAGGCTCAAACCACCATCTGGG + Intergenic
1039082356 8:33745501-33745523 TGGGACACAGGGCACCATGTCGG + Intergenic
1041497802 8:58506379-58506401 GGGTAAACACACCACCAACTGGG + Intergenic
1047946196 8:129883241-129883263 TAGGAAATACACCAACATCTTGG + Intronic
1049604378 8:143522219-143522241 TGGGCCACACACAACCCTGTGGG + Intronic
1053782810 9:41628930-41628952 TGAGACACCCACCACCATCCAGG + Intergenic
1054170761 9:61839070-61839092 TGAGACACCCACCACCATCCAGG + Intergenic
1054666775 9:67741737-67741759 TGAGACACCCACCACCATCCAGG - Intergenic
1056279567 9:85028063-85028085 TGAGAGGCACACCAGCATCTGGG + Intergenic
1056766003 9:89445023-89445045 TGCGACACTCACCAGGATCTGGG + Intronic
1057295283 9:93830985-93831007 TGTGCCACACACCACCCTTTTGG + Intergenic
1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG + Intergenic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1060332536 9:122686146-122686168 TGAAACACACACCACCATCCAGG + Intergenic
1060761856 9:126259388-126259410 TGAAAGACAAACCACCATCTGGG - Intergenic
1061482466 9:130903733-130903755 TGGGGCAGACTCCACCATCCTGG + Exonic
1185603323 X:1353966-1353988 TGGGACCCCCACCCCCATCATGG + Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619214 X:1443093-1443115 TGGGACACACACCGTCGTCGTGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1190250140 X:48717137-48717159 TGGGACACACACCACCAAATAGG + Intergenic
1201902548 Y:19058256-19058278 TGGGATACACAACAGCATTTGGG - Intergenic