ID: 1185620083 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:1448744-1448766 |
| Sequence | GTGGTGCTTATCCAAGATGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185620083_1185620088 | 4 | Left | 1185620083 | X:1448744-1448766 | CCACCATCTTGGATAAGCACCAC | No data | ||
| Right | 1185620088 | X:1448771-1448793 | TTGGACACACACCGCCATCTTGG | No data | ||||
| 1185620083_1185620091 | 23 | Left | 1185620083 | X:1448744-1448766 | CCACCATCTTGGATAAGCACCAC | No data | ||
| Right | 1185620091 | X:1448790-1448812 | TTGGATAAGCACCACCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185620083 | Original CRISPR | GTGGTGCTTATCCAAGATGG TGG (reversed) | Intronic | ||