ID: 1185620084

View in Genome Browser
Species Human (GRCh38)
Location X:1448747-1448769
Sequence ATGGTGGTGCTTATCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620084_1185620088 1 Left 1185620084 X:1448747-1448769 CCATCTTGGATAAGCACCACCAT No data
Right 1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG No data
1185620084_1185620091 20 Left 1185620084 X:1448747-1448769 CCATCTTGGATAAGCACCACCAT No data
Right 1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620084 Original CRISPR ATGGTGGTGCTTATCCAAGA TGG (reversed) Intronic