ID: 1185620085

View in Genome Browser
Species Human (GRCh38)
Location X:1448752-1448774
Sequence TTGGATAAGCACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620077_1185620085 20 Left 1185620077 X:1448709-1448731 CCACCATCTTGGACACACACCAT No data
Right 1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG No data
1185620081_1185620085 1 Left 1185620081 X:1448728-1448750 CCATCTGGGACACACACCACCAT No data
Right 1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG No data
1185620078_1185620085 17 Left 1185620078 X:1448712-1448734 CCATCTTGGACACACACCATCTG No data
Right 1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620085 Original CRISPR TTGGATAAGCACCACCATCT TGG Intronic