ID: 1185620088

View in Genome Browser
Species Human (GRCh38)
Location X:1448771-1448793
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620083_1185620088 4 Left 1185620083 X:1448744-1448766 CCACCATCTTGGATAAGCACCAC No data
Right 1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG No data
1185620081_1185620088 20 Left 1185620081 X:1448728-1448750 CCATCTGGGACACACACCACCAT No data
Right 1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG No data
1185620084_1185620088 1 Left 1185620084 X:1448747-1448769 CCATCTTGGATAAGCACCACCAT No data
Right 1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type