ID: 1185620091

View in Genome Browser
Species Human (GRCh38)
Location X:1448790-1448812
Sequence TTGGATAAGCACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620086_1185620091 4 Left 1185620086 X:1448763-1448785 CCACCATCTTGGACACACACCGC No data
Right 1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG No data
1185620084_1185620091 20 Left 1185620084 X:1448747-1448769 CCATCTTGGATAAGCACCACCAT No data
Right 1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG No data
1185620083_1185620091 23 Left 1185620083 X:1448744-1448766 CCACCATCTTGGATAAGCACCAC No data
Right 1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG No data
1185620087_1185620091 1 Left 1185620087 X:1448766-1448788 CCATCTTGGACACACACCGCCAT No data
Right 1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620091 Original CRISPR TTGGATAAGCACCACCATCT TGG Intronic