ID: 1185620097

View in Genome Browser
Species Human (GRCh38)
Location X:1448847-1448869
Sequence TTTGACACACACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620092_1185620097 23 Left 1185620092 X:1448801-1448823 CCACCATCTTGGACAAGCACTGC No data
Right 1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG No data
1185620096_1185620097 1 Left 1185620096 X:1448823-1448845 CCATCTTGGACATGCATGGTCAT No data
Right 1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG No data
1185620093_1185620097 20 Left 1185620093 X:1448804-1448826 CCATCTTGGACAAGCACTGCCAT No data
Right 1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620097 Original CRISPR TTTGACACACACCACCATCT TGG Intronic