ID: 1185620097

View in Genome Browser
Species Human (GRCh38)
Location X:1448847-1448869
Sequence TTTGACACACACCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 2, 1: 0, 2: 21, 3: 36, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620092_1185620097 23 Left 1185620092 X:1448801-1448823 CCACCATCTTGGACAAGCACTGC 0: 1
1: 1
2: 13
3: 68
4: 194
Right 1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG 0: 2
1: 0
2: 21
3: 36
4: 205
1185620096_1185620097 1 Left 1185620096 X:1448823-1448845 CCATCTTGGACATGCATGGTCAT 0: 1
1: 2
2: 2
3: 30
4: 214
Right 1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG 0: 2
1: 0
2: 21
3: 36
4: 205
1185620093_1185620097 20 Left 1185620093 X:1448804-1448826 CCATCTTGGACAAGCACTGCCAT 0: 25
1: 45
2: 54
3: 108
4: 215
Right 1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG 0: 2
1: 0
2: 21
3: 36
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620097 Original CRISPR TTTGACACACACCACCATCT TGG Intronic
901383915 1:8894059-8894081 TTTGACACACATGGCCACCTTGG + Intergenic
903876254 1:26475428-26475450 TTTGACACACATGGCCACCTTGG + Exonic
906035535 1:42748232-42748254 TTTGACACACACGAGGGTCTCGG + Exonic
906039751 1:42778989-42779011 TTTGACAGACACCAAAATGTGGG - Intronic
907056343 1:51372241-51372263 CTTGACACACACCGCCCACTAGG - Intronic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
910015906 1:82522922-82522944 AATGACACACACAACCATCAAGG - Intergenic
910668101 1:89745769-89745791 TTTGTCACCCATCAGCATCTTGG - Intronic
914932118 1:151944307-151944329 TTTGCCACACACTTCAATCTTGG - Intergenic
915336937 1:155149407-155149429 TTTGACACACATGGCCACCTTGG + Intergenic
915535261 1:156531501-156531523 TCTGACACCCACCACCCTCTTGG + Intronic
916335065 1:163661878-163661900 TTTCACATACACCACCACCCTGG + Intergenic
916491394 1:165305370-165305392 TATGACATATAACACCATCTGGG + Intronic
919489114 1:198183124-198183146 TTTCACAAATACCACCATTTTGG - Intronic
920362543 1:205429314-205429336 TTTGAAACACACCACCAGCGTGG - Intronic
922952544 1:229571084-229571106 TTTGACACACATGGCCACCTTGG + Intergenic
1068050099 10:51939609-51939631 TTTGAGAAACACCACTATCTTGG + Intronic
1070415847 10:76188544-76188566 TTAGACACATTCCACCATCTGGG - Intronic
1074765072 10:116694592-116694614 TTTGAAACGCACCAACATCCTGG + Intronic
1081751556 11:45514725-45514747 TTTGACACACATAGCCACCTTGG + Intergenic
1082044825 11:47716318-47716340 TTGATCACACAGCACCATCTGGG + Intergenic
1082186819 11:49192527-49192549 TTTGACAAATGCCAACATCTGGG - Intronic
1085074736 11:73580791-73580813 TTTGACACACATGGCCACCTTGG + Intronic
1086054731 11:82633335-82633357 TTTGTAACACACCACCAAGTAGG - Intergenic
1088422743 11:109667217-109667239 TCTGTCTCACACCTCCATCTGGG - Intergenic
1089940292 11:122409531-122409553 TTTCACCCACACCCCCATCAAGG - Intergenic
1091481647 12:838554-838576 ATGGACACACACCACCATGCTGG + Intronic
1092061358 12:5553543-5553565 TGTGATCCACACCACCAGCTTGG - Intronic
1093272014 12:17075162-17075184 TTTGAAACACAGCACCAGCCAGG - Intergenic
1098379250 12:69851798-69851820 ACAGACACACACCACCATCTTGG + Intronic
1099732999 12:86529033-86529055 TTTGACACAGACAACCAGATAGG + Intronic
1101798504 12:108000452-108000474 TCTGAGACACCCCACCCTCTAGG - Intergenic
1102811458 12:115827696-115827718 TGTGTCACACACCACCATCACGG + Intergenic
1102964418 12:117114809-117114831 CTTTACAGACACCACCACCTGGG - Intergenic
1103033472 12:117637268-117637290 TTTGACACTCATCCCCACCTCGG + Intronic
1105594670 13:21826019-21826041 TTTGACTAACAGCAGCATCTGGG + Intergenic
1108577072 13:51799818-51799840 TCTCACAAACACCACTATCTCGG + Intronic
1108647777 13:52448068-52448090 TTTCACACCCACAACCAGCTAGG + Intronic
1108764299 13:53607745-53607767 TGTGTCACACTACACCATCTTGG + Intergenic
1110277651 13:73658103-73658125 TTTCACAATCGCCACCATCTGGG - Intergenic
1111827994 13:93293122-93293144 ACAGGCACACACCACCATCTCGG + Intronic
1112255013 13:97821628-97821650 TTTGACACAAAATACCACCTTGG - Intergenic
1114511289 14:23263609-23263631 TTTGACACACATGGCCACCTTGG - Intronic
1116354302 14:43908638-43908660 TCTGGCACAAACAACCATCTGGG + Intergenic
1116770120 14:49117685-49117707 TTTTACACCCACCACAATCTGGG + Intergenic
1117653454 14:57930056-57930078 TTTTGCTAACACCACCATCTTGG - Intronic
1117941524 14:60971958-60971980 TTTGACACACATGGCCACCTTGG - Exonic
1118214219 14:63793201-63793223 GTTGACACACACAGCCACCTTGG + Intergenic
1120100992 14:80445580-80445602 TTTCACACACACCACTGTTTTGG + Intergenic
1122481833 14:102052273-102052295 ACAGACACACACCACCATGTCGG + Intergenic
1122518612 14:102326724-102326746 TTTCTCAGACAGCACCATCTCGG - Exonic
1123159066 14:106260030-106260052 TTTCCCACACAGAACCATCTCGG - Intergenic
1123207811 14:106730406-106730428 TTTCCCACACAGAACCATCTCGG - Intergenic
1124445858 15:29731262-29731284 TTTGACACACATGGCCACCTTGG + Intronic
1130252129 15:82306478-82306500 TTTGACCCACAGAACCCTCTGGG - Intergenic
1133352674 16:5112453-5112475 TTTAAAACTCACCACCAGCTGGG - Intergenic
1133720685 16:8491637-8491659 TTTGCCACCCACCCCCACCTTGG - Intergenic
1135858295 16:26032239-26032261 TTTGACACACATGGCCACCTTGG - Intronic
1135861641 16:26061447-26061469 TTTGACCTCCACCACCATCTTGG + Intronic
1137062329 16:35802612-35802634 TTTGACACACATGGCCACCTTGG - Intergenic
1141789460 16:86224508-86224530 TGTGACAGACACCCCCATTTTGG - Intergenic
1141844255 16:86596375-86596397 TTTAACCCTCACCACCACCTCGG - Intergenic
1145986865 17:29052879-29052901 TTTGAAACACACCTTCACCTAGG + Intronic
1146579644 17:34025338-34025360 TCTGACACCCAGCACCATTTTGG - Intronic
1147383110 17:40067244-40067266 TGGGACACACCCCACCAGCTAGG + Intronic
1147753567 17:42753233-42753255 TTTGACACACATGGCCACCTTGG - Intergenic
1150171824 17:63004404-63004426 TTTGACACACATAGCCACCTTGG - Intergenic
1153729082 18:7989351-7989373 TTAGCCCCAAACCACCATCTTGG + Intronic
1154637500 18:16876670-16876692 TGAGACACCCACCACCATCCAGG - Intergenic
1155824183 18:30418383-30418405 TTTGAGACACACTGCCATTTGGG + Intergenic
1158591390 18:58781807-58781829 TTATACACACACCACCACCAAGG - Intergenic
1160273700 18:77410847-77410869 TGTGACAAACACCACAACCTGGG + Intergenic
1166251687 19:41575876-41575898 TGTGACACACAAAACCAGCTGGG - Intronic
1167614258 19:50523229-50523251 CCTGGCACACACCACTATCTGGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
928245778 2:29625865-29625887 CTTGGCACCCACCACCCTCTTGG - Intronic
929799313 2:45085706-45085728 TTTGACAGTTACCACCCTCTAGG - Intergenic
935168454 2:100590445-100590467 TTTGACACACATGACCACCTTGG - Intergenic
936492082 2:112980868-112980890 TTTGACACACATGGCCACCTTGG - Intronic
937598230 2:123695939-123695961 TTTGACCCACAGCCCCTTCTTGG - Intergenic
939617027 2:144373176-144373198 TTTGATTCTCACAACCATCTTGG + Intergenic
939953891 2:148508780-148508802 TTTGAAACATAGGACCATCTGGG + Intronic
940164014 2:150747901-150747923 CTTGACAAATAGCACCATCTTGG - Intergenic
940891768 2:159042337-159042359 GTTCAAACACACCACCAACTAGG - Intronic
942120157 2:172768982-172769004 CTTGCCCCACACCACCATGTTGG - Intronic
947536687 2:230944121-230944143 TTACACACACAACAGCATCTTGG + Intronic
948200277 2:236124619-236124641 TTTGACACACACCATCATAGGGG - Exonic
948316717 2:237032799-237032821 GTCTACACACACCACCATGTGGG + Intergenic
1169443225 20:5650408-5650430 TTTGACTCACACCACAACCCAGG + Intergenic
1175284638 20:57829904-57829926 TTTGACAGGAACCACCCTCTCGG + Intergenic
1176139004 20:63537037-63537059 TTTGGCACAGGCCACCCTCTAGG - Intronic
1176402094 21:6323075-6323097 TTTCTCTCACACCCCCATCTCGG + Intergenic
1176435063 21:6666029-6666051 TTTCTCTCACACCCCCATCTCGG - Intergenic
1176459325 21:6993099-6993121 TTTCTCTCACACCCCCATCTCGG - Intergenic
1176686510 21:9852662-9852684 TGAGACACCCACCACCATCCAGG - Intergenic
1177779470 21:25607345-25607367 CTAGACAGACACCACTATCTAGG + Intronic
1180101959 21:45592134-45592156 TTAGACACACATCAGCAGCTGGG + Intergenic
1182175279 22:28279682-28279704 TTTGACACACACATACACCTAGG + Intronic
1183374854 22:37457264-37457286 TTTAACAAACATGACCATCTGGG - Intergenic
1183543965 22:38445899-38445921 TTTGTGACACACAACCATGTGGG + Intronic
1185373177 22:50470165-50470187 TTGGCCCCAAACCACCATCTGGG + Intronic
950778962 3:15374767-15374789 TTTGACACACATGGCCACCTTGG - Intergenic
953183082 3:40614690-40614712 TTTGACACTCCGCTCCATCTGGG + Intergenic
954370335 3:50166741-50166763 TTTGACACCCACCAGCCTGTTGG + Intronic
956974052 3:74559580-74559602 TGAGACACACACAACCAACTTGG + Intergenic
958044166 3:88263519-88263541 TTTGACTCACACCACCGTGCCGG - Intergenic
958803718 3:98784538-98784560 TGTGAAACACACCTCCATATAGG - Intronic
960580262 3:119272062-119272084 TCTGACACACACAAACAACTGGG + Intergenic
961357090 3:126346083-126346105 TGTGACACACACACCCATCCAGG - Intronic
962957022 3:140275749-140275771 CTTGACACTCACCTCCAGCTAGG + Intronic
964601543 3:158506336-158506358 TGTGACACATACTCCCATCTCGG - Intronic
964814539 3:160702797-160702819 TTTGACAGACACTACCAAATGGG + Intergenic
971635427 4:29050962-29050984 TCTGACAATCACAACCATCTGGG - Intergenic
972559383 4:40213387-40213409 TCTCACACACACACCCATCTTGG + Intronic
974408374 4:61506328-61506350 TTTAAAATACAACACCATCTTGG + Intronic
974990763 4:69085753-69085775 TTGGACACATACCACCAACCAGG - Intronic
977836894 4:101655864-101655886 TTAGATACACACCACAATATAGG - Intronic
980349958 4:131671131-131671153 TGAGACACCCACCACCATCCAGG - Intergenic
980493873 4:133566296-133566318 TTAGACACACAACAACAGCTGGG + Intergenic
981360109 4:143836410-143836432 TTTGTTCCACACCAACATCTGGG - Intergenic
981370881 4:143957478-143957500 TTTGTTCCACACCAACATCTGGG - Intergenic
986117074 5:4785720-4785742 TTTTACACACTGCACCATCCAGG + Intergenic
986773054 5:10990635-10990657 TTTAATAAACACCACCATCTGGG - Intronic
987072491 5:14351491-14351513 TTTGACAAAGACAATCATCTGGG - Intronic
991706032 5:69359587-69359609 TTTGACAAACAGCAGCAGCTGGG - Intronic
992101367 5:73410702-73410724 TTTGACACACATGGCCACCTTGG + Intergenic
992381455 5:76241721-76241743 TTTGACACACATGGCCACCTTGG - Intronic
996368518 5:122728175-122728197 TATGCCACACAGCATCATCTGGG - Intergenic
998637380 5:143971306-143971328 TTTGCCCAACACCACCCTCTTGG - Intergenic
1002261161 5:177994971-177994993 CTGGACACACACGACCACCTGGG + Intronic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1007407469 6:41643291-41643313 CTTGACACACTCAGCCATCTGGG + Intronic
1009972443 6:70639163-70639185 TTTGACAAACAGCTTCATCTCGG - Intergenic
1009996533 6:70901477-70901499 TTTGACACACACACCAATGTGGG - Intronic
1010727702 6:79354157-79354179 TTTGACACACATGGCCACCTTGG - Intergenic
1010917455 6:81637861-81637883 TTGCACTTACACCACCATCTTGG + Intronic
1014434772 6:121409088-121409110 TTTGACACACATGGCCAGCTTGG + Intergenic
1015649840 6:135444355-135444377 TTTGAGACACTCCACAATGTGGG + Intronic
1017333391 6:153225860-153225882 TGTGCCATACACCACCATCCTGG + Intergenic
1017545140 6:155442561-155442583 TTTTCCACATACCACCATATTGG - Intronic
1018255617 6:161915636-161915658 TTTGACACACAGCATGATGTAGG - Intronic
1018530445 6:164757585-164757607 TATGATACACACCACCACCATGG + Intergenic
1022053422 7:26702874-26702896 TATGAGACACATCAACATCTCGG + Intronic
1027397934 7:77775476-77775498 TGTGAAACACAGCACGATCTCGG - Intronic
1028712826 7:93929302-93929324 ATTGATACACACAACCAACTTGG - Intergenic
1029688344 7:102164223-102164245 TTTGAGACCCACCAGCAACTCGG - Intronic
1031798383 7:126208537-126208559 TTTCACAAACAACACCTTCTAGG - Intergenic
1034395025 7:150815865-150815887 TTTTTCACACATCAACATCTAGG - Intergenic
1036029420 8:4951116-4951138 TCTGACACACACCCTCCTCTTGG + Intronic
1040456088 8:47599204-47599226 TCTGCCCCACACCAGCATCTTGG - Intronic
1046789636 8:118307275-118307297 TTTCACACACAACAACATTTGGG - Intronic
1047358580 8:124146347-124146369 TTTGCCTCTCACCCCCATCTGGG - Intergenic
1047679590 8:127240808-127240830 TTTGACACCCACCATCATCCAGG + Intergenic
1050406323 9:5312182-5312204 TTTGACACACATGGCCACCTTGG + Intergenic
1051101212 9:13524093-13524115 TTTGTCACACAAGACCATGTGGG + Intergenic
1051694635 9:19754713-19754735 TTTGGCACATACCACCACCAGGG - Intronic
1053782810 9:41628930-41628952 TGAGACACCCACCACCATCCAGG + Intergenic
1054170761 9:61839070-61839092 TGAGACACCCACCACCATCCAGG + Intergenic
1054666775 9:67741737-67741759 TGAGACACCCACCACCATCCAGG - Intergenic
1056180665 9:84079297-84079319 TTTGACACACATGGCCACCTTGG + Intergenic
1056371269 9:85957001-85957023 TTTAAAACAAACCACCCTCTTGG + Intronic
1057295283 9:93830985-93831007 TGTGCCACACACCACCCTTTTGG + Intergenic
1059940078 9:119350160-119350182 GGGGACACACACCAGCATCTGGG + Intronic
1060332536 9:122686146-122686168 TGAAACACACACCACCATCCAGG + Intergenic
1060887614 9:127166815-127166837 TCTTACACACCCCACCATCATGG - Intronic
1203436473 Un_GL000195v1:142618-142640 TTTCTCTCACACCCCCATCTCGG + Intergenic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619206 X:1443036-1443058 TTGGACGCATACCACCATCGTGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619219 X:1443131-1443153 GTGGACACACGCCGCCATCTTGG + Intronic
1185619222 X:1443150-1443172 TTGGACACACACCGCCATCGTGG + Intronic
1185619225 X:1443169-1443191 GTGGACACACACCGCCATCGTGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619256 X:1443378-1443400 ATGGACACACGCCGCCATCTTGG + Intronic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619289 X:1443594-1443616 TTGGACAGACACCGCCATCGTGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1185619301 X:1443670-1443692 ATGGACACACACCGCCATCGTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619308 X:1443717-1443739 GTGGACACACACCCCCATCGTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619318 X:1443780-1443802 GTGGACACACACCCCCATCGTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619330 X:1443843-1443865 GAGGACACACACCACCATCGTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619870 X:1447270-1447292 TTCGACACACACTGCCATCTTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619884 X:1447362-1447384 TTGGACACACATGGCCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619897 X:1447454-1447476 TTGGACACACACGGCCATGTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619948 X:1447803-1447825 TTGGACACACACAGCTATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619956 X:1447876-1447898 TTGGACCCATAACACCATCTTGG + Intronic
1185619960 X:1447895-1447917 TTGGACAAGCACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620025 X:1448350-1448372 TTGGACCCATAACACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1187938005 X:24354518-24354540 TTTGACACACATGGCCACCTTGG + Intergenic
1190250140 X:48717137-48717159 TGGGACACACACCACCAAATAGG + Intergenic
1192198732 X:69049991-69050013 TTTCCCACACACAACCAACTCGG - Intergenic
1199999595 X:153051854-153051876 TTTGACACACATGGCCACCTTGG - Intergenic
1200960407 Y:8991249-8991271 TTTCACAGACACCAGCCTCTGGG + Intergenic