ID: 1185620100 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:1448866-1448888 |
Sequence | TTGGACACACACCGCCATCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1185620096_1185620100 | 20 | Left | 1185620096 | X:1448823-1448845 | CCATCTTGGACATGCATGGTCAT | No data | ||
Right | 1185620100 | X:1448866-1448888 | TTGGACACACACCGCCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1185620100 | Original CRISPR | TTGGACACACACCGCCATCT TGG | Intronic | ||