ID: 1185620100

View in Genome Browser
Species Human (GRCh38)
Location X:1448866-1448888
Sequence TTGGACACACACCGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185620096_1185620100 20 Left 1185620096 X:1448823-1448845 CCATCTTGGACATGCATGGTCAT No data
Right 1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620100 Original CRISPR TTGGACACACACCGCCATCT TGG Intronic