ID: 1185620100 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:1448866-1448888 |
| Sequence | TTGGACACACACCGCCATCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185620096_1185620100 | 20 | Left | 1185620096 | X:1448823-1448845 | CCATCTTGGACATGCATGGTCAT | No data | ||
| Right | 1185620100 | X:1448866-1448888 | TTGGACACACACCGCCATCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185620100 | Original CRISPR | TTGGACACACACCGCCATCT TGG | Intronic | ||