ID: 1185620324

View in Genome Browser
Species Human (GRCh38)
Location X:1450065-1450087
Sequence GGTGATGGGGGCATAGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 1, 2: 4, 3: 16, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185620324 Original CRISPR GGTGATGGGGGCATAGTTAC TGG (reversed) Intronic
901965946 1:12866414-12866436 GGATATGGGGCCAAAGTTACTGG + Intronic
901981340 1:13036794-13036816 GGATATGGGGCCAAAGTTACTGG + Intronic
902000745 1:13192135-13192157 GGATATGGGGCCAAAGTTACTGG - Intergenic
902019975 1:13337839-13337861 GGATATGGGGCCAAAGTTACTGG - Intergenic
904905906 1:33897004-33897026 GGTGGAGGGGGCAGGGTTACAGG + Intronic
907634350 1:56118480-56118502 GGTGAGGGTGGTATAGTTAAAGG + Intergenic
907967041 1:59341973-59341995 GGTGTTGGGGGCAGAGTTAGAGG + Intronic
911101916 1:94102060-94102082 GGTGATTTGTGCACAGTTACAGG - Intronic
911797738 1:102095454-102095476 GGTGATGGGGCTATAGTTATGGG - Intergenic
913035018 1:114956247-114956269 GGTGGTGGGGGGACAGTCACAGG + Intronic
914335821 1:146714368-146714390 GGTGGTGGGGGGATGGTTTCAGG - Intergenic
914456005 1:147837052-147837074 GGTAATGAGGGGAAAGTTACTGG + Intergenic
917028734 1:170667239-170667261 GGTGATGGGGACGAAGTGACAGG + Intronic
918188154 1:182145676-182145698 CGTGTTGGGGGCATGGTTGCTGG + Intergenic
921293941 1:213684430-213684452 GGTAATGGGGACACAGTGACTGG - Intergenic
1068970891 10:62956994-62957016 GGTGGTTGGGGGATAGTTTCAGG + Intergenic
1072056057 10:91756971-91756993 GGGGATGGGGGGATGGTTTCGGG + Intergenic
1073351931 10:102826005-102826027 GCTGATGGGGGCAGAGGAACCGG - Intergenic
1073872185 10:107878169-107878191 GGTGATGGGTTGATAGGTACAGG + Intergenic
1078437865 11:11340311-11340333 GGGGATGGGGGCACACCTACAGG - Intronic
1084667531 11:70584503-70584525 GGTGATGGGGGCAGGGTTAGTGG - Intronic
1087149279 11:94844134-94844156 GGTGGTGGTGGCAGAGTTAAAGG - Intronic
1087428398 11:98019196-98019218 GGTGTTGGGGAGATGGTTACGGG + Intergenic
1088812440 11:113400710-113400732 GGTGATGGGGGCATGGGGAGAGG + Intergenic
1090691462 11:129187372-129187394 GGTGGTGGGGGCATAGTGGGAGG + Intronic
1095408819 12:41899420-41899442 GGTAATGGGGGGATGGTTAATGG + Intergenic
1101818965 12:108168388-108168410 GGAGATGGGGGCAGAGTAAAGGG - Intronic
1103887248 12:124211848-124211870 GGTGATGGAGGCCAAGTGACTGG - Intronic
1108346849 13:49554762-49554784 GGTGTTGGGGGCATGGTTTTGGG - Intronic
1109926495 13:69147700-69147722 GGTGATTGGCTCATACTTACCGG + Intergenic
1111275813 13:85945689-85945711 GGTGATGGTGGCAGGGATACAGG - Intergenic
1112531908 13:100212847-100212869 GGTGATGTGGGGATGGTTAATGG - Intronic
1115892273 14:38044641-38044663 GGAGATGTGGGCATAGTAAGAGG + Intergenic
1117833938 14:59782298-59782320 GGTCATGAAGGCATTGTTACTGG + Intronic
1119864199 14:77959507-77959529 GGTGATGGGGGCACATTGATAGG + Intergenic
1120121925 14:80691326-80691348 GGTGATGGGGGGATGGTATCTGG + Intronic
1120428441 14:84381375-84381397 GGGGATGGGGGGATGGTTTCAGG + Intergenic
1120442531 14:84558517-84558539 GCTGATGGGGGCATTGTTTTGGG + Intergenic
1122864093 14:104595739-104595761 CGTGATGGGGGCAGAGCTTCTGG - Intronic
1124228997 15:27925581-27925603 GGTGCTGGGGGCATGGTTTGAGG + Intronic
1126434176 15:48619063-48619085 GGGGATGGGGGGATGGTTTCAGG - Intronic
1129332258 15:74833701-74833723 GGGGCTGGGGGTGTAGTTACAGG + Intergenic
1133764740 16:8830045-8830067 TGTGATGGGGCTACAGTTACAGG + Intronic
1136235501 16:28911212-28911234 GGTGAGGGGGGCCAAGTTCCTGG - Intronic
1136252153 16:29012412-29012434 GGCCATGGGGGCAGAGTTCCAGG - Intergenic
1137639698 16:50017810-50017832 GGTGGTGGGGGGATGGTTTCCGG - Intergenic
1138425521 16:56929521-56929543 GGTGGGGGGGGCATTGTTTCAGG + Intergenic
1139936787 16:70577363-70577385 GGTGATGGGGGCACAGCCACAGG - Exonic
1140038582 16:71390099-71390121 GGTGATGGGGGCATGGGTGGAGG + Exonic
1140522915 16:75597531-75597553 GGGGATAGGGGGATAGTTTCGGG + Intronic
1140958146 16:79886711-79886733 GGTGATGAGGGCCTAGTCAATGG + Intergenic
1141188540 16:81806872-81806894 GGTGATGGGGGCAGAGTTATGGG + Intronic
1144243959 17:13345006-13345028 GGTGATGGGGTTATGATTACAGG - Intergenic
1146701332 17:34962664-34962686 GGTGAAAGGGGCATTGTTATAGG + Exonic
1147470204 17:40651348-40651370 GGTGATGGAGACAGAGTTAGGGG + Intergenic
1147721046 17:42539553-42539575 GGTGATGGGGGCAAAGAGGCGGG - Intronic
1151557608 17:74854542-74854564 GGTGATGGGGAGATGGTTATGGG - Intronic
1152328833 17:79658679-79658701 GATGATGGAGGCAGAGATACTGG - Intergenic
1156656437 18:39294067-39294089 GGGTAAGGGGGCATAGTTAGAGG + Intergenic
1157319578 18:46623951-46623973 TGAGATGGGGGCTTAGTTACGGG - Intronic
1163359657 19:16837685-16837707 AGTGATGGGGACAGAGTGACTGG + Intronic
1164739984 19:30568771-30568793 GGTGATGGGGGCAAAGATTTAGG + Intronic
1165348928 19:35266395-35266417 GGTGCTGGGGGCATAAATGCTGG - Exonic
1165429575 19:35764940-35764962 GGTGATGGGGGCAGGGGTGCGGG - Intronic
1166367561 19:42285022-42285044 GGTGAGGGGTGCAGAGTAACTGG + Intronic
1168713143 19:58513018-58513040 GGTGCTGGGGGCAAAGTTCAGGG - Intergenic
925007088 2:451945-451967 GGTGGTGGGGGGATGGTTTCGGG + Intergenic
932217581 2:69976782-69976804 TTTGATGGGGGCACAGTGACAGG - Intergenic
932771952 2:74505427-74505449 GGAGATGGGGGCATAATTTTAGG + Intronic
936687243 2:114842139-114842161 GGTAATGGGGGCTGAGTTTCAGG + Intronic
938661519 2:133491713-133491735 GGAGATGGGAGCATAGTTGAAGG + Intronic
940665225 2:156600923-156600945 GGTGGTGGGTGCTTAGTTATTGG - Intronic
942254732 2:174085481-174085503 GGTGATGGGGGTGTGGTTTCAGG - Intronic
944300906 2:198123875-198123897 GGAGAGGGGTGCATAGTTTCAGG - Intronic
947937099 2:234016592-234016614 GGAGATGGGGGAATTGGTACAGG - Intronic
1173559179 20:43990396-43990418 GATGTTTGGGGCATAGTTACAGG + Intronic
1173803655 20:45910702-45910724 GGTGATGGAGGCAAAGTGAACGG - Intronic
1174875758 20:54224525-54224547 GGTCATGGGTCCATAGTTATTGG + Intronic
1175039594 20:56035684-56035706 GATGAAGGGGCCATAGTCACGGG - Intergenic
1179057109 21:37946405-37946427 GGTGGTGGGGGGATAGTTTCAGG - Intergenic
1181314754 22:21963954-21963976 GGTGATGGGGGGATGGTCGCCGG + Exonic
1181329369 22:22077496-22077518 GGTGATGTGGGGATGGTTAATGG - Intergenic
1182134077 22:27884193-27884215 GGTAATGGGGACACAATTACGGG - Intronic
1182580328 22:31305169-31305191 GGTGATGGGGGGATGGTTTCAGG - Intergenic
1183160311 22:36108831-36108853 GGAGATGGGGGGATGGTTTCAGG + Intergenic
949881228 3:8662452-8662474 TGTGAAGGGGGCATAATGACAGG + Intronic
949962324 3:9322682-9322704 GGTGATGGGGGGATGGTCTCAGG - Intronic
951714387 3:25623603-25623625 GGTGCTGAGGGCATTGGTACTGG - Exonic
952433653 3:33250029-33250051 GGTGAGGAGGGCATGGTTAATGG - Intergenic
952459013 3:33504677-33504699 GGTGATGGGGGGATGGTTTCAGG + Intronic
953717062 3:45324604-45324626 GGAGATGGGGGCACAGTGCCAGG + Intergenic
958026604 3:88058156-88058178 GGTGGTGGGGAAATAGTTTCTGG + Intronic
959074384 3:101734832-101734854 GGTGATGTGGGCAGAGATAAAGG + Intronic
960704075 3:120465048-120465070 GTTTATGGGGGGAAAGTTACAGG + Intergenic
966868106 3:184272375-184272397 GGGGAGGGGGGGATGGTTACGGG + Intronic
967250892 3:187536870-187536892 GGTGGTGGGGGGATGGTTTCGGG + Intergenic
968563140 4:1295635-1295657 GGTGAGGGGGGTACAGGTACGGG - Intronic
968563184 4:1295757-1295779 GGTGAGGGGGGCAGAGGCACGGG - Intronic
968563243 4:1295952-1295974 GGTGAGGGGGGCACAGGTGCGGG - Intronic
968563264 4:1296022-1296044 GGTGAGGGGGGCACAGGCACAGG - Intronic
968563300 4:1296153-1296175 GGTGAGGGGGGCACAGGTGCGGG - Intronic
968563321 4:1296223-1296245 GGTGAGGGGGGCACAGGCACAGG - Intronic
968563357 4:1296354-1296376 GGTGAGGGGGGCACAGGTGCGGG - Intronic
968563381 4:1296447-1296469 GGTGAGGGGGGCACAGGCACGGG - Intronic
970978619 4:22071158-22071180 GGTGATGGGGATATAGTGATTGG - Intergenic
972594066 4:40514786-40514808 GGTGGTGGGGGCGGAGTTGCCGG + Intronic
973085360 4:46052672-46052694 GCTCATGGGGCCATATTTACTGG - Intronic
975038201 4:69710653-69710675 GGTGATTTGGGTATAGTTAAAGG - Intergenic
976241720 4:82964869-82964891 GGGCATGGTGGCATAGCTACTGG + Intronic
977375488 4:96197532-96197554 GGTGGGGGGGGTTTAGTTACCGG + Intergenic
978215632 4:106198885-106198907 GGTAATGGCAGCAAAGTTACAGG + Intronic
983694759 4:170514374-170514396 GCTGAAAGGGGCATAGTTATTGG + Intergenic
985112832 4:186563839-186563861 GGTGAGGGGGGCTTGGTTAGTGG - Intergenic
987628525 5:20435446-20435468 GAGGTTGGGGGCATAGATACTGG - Intronic
987753271 5:22068285-22068307 CGTGATGAGGCCATAGGTACAGG - Intronic
988845470 5:35123096-35123118 GGTGTGGGTGGCCTAGTTACAGG + Intronic
989342117 5:40387699-40387721 GGGCATGGGGGCATGGTTAAAGG + Intergenic
991051000 5:62272775-62272797 GGCGATGGGGGCATGCTTACTGG - Intergenic
993157172 5:84240655-84240677 GGTGGTTGGGGAATAGTTTCAGG - Intronic
993582860 5:89684547-89684569 GGTGAGGTGGGGATAGTTAATGG + Intergenic
993950227 5:94165876-94165898 GGTGAGGTGGGTATAGTTAATGG + Intronic
995956407 5:117782164-117782186 GGAGAAGGGGGCATATTTACAGG + Intergenic
996432216 5:123394320-123394342 GGTATAGGGGGAATAGTTACAGG + Intronic
996877485 5:128255241-128255263 GTTGATGGGGGCAGGGTTTCTGG - Intergenic
999234483 5:150082215-150082237 AGTGATGGGGGCACAATGACAGG + Intronic
1000699736 5:164433875-164433897 GCTGATGGGGCCACAGTTGCTGG + Intergenic
1002215824 5:177631899-177631921 GGTGATGGTGGCATGGTTCCTGG + Intergenic
1002536290 5:179877894-179877916 GGTGATCGGGGCATGTTTAATGG + Intronic
1002839917 6:896634-896656 GGTGTTGTGGGTATAGATACGGG + Intergenic
1004893861 6:20127810-20127832 GGTGGTGGGGGGATGGTTTCAGG - Intronic
1006657822 6:35611501-35611523 GGGGATGGGGGAAGAGTAACTGG + Intronic
1009920966 6:70060817-70060839 CCTGATGGGGGCATGGTTTCAGG - Intronic
1012947341 6:105481539-105481561 GGAGGTGGGAACATAGTTACAGG + Intergenic
1017737181 6:157375980-157376002 GGGGATGGGGGCATGGTTTTGGG - Intergenic
1019743021 7:2684501-2684523 GGTGATGGGGTCAAAGTTGGGGG + Intronic
1020826508 7:13035757-13035779 GGTGGTGGGGGAATAGTTTCTGG - Intergenic
1021786732 7:24159712-24159734 TGGGATGGGGGCATAGCTAAGGG - Intergenic
1021804544 7:24342190-24342212 AGTGATGGTGGCTTAGTTAAGGG - Intergenic
1027225714 7:76242523-76242545 GGTGGTGGGGGGATGGTTTCAGG + Intronic
1027883714 7:83875190-83875212 CTTGATGAGGGCATAGTGACTGG + Intergenic
1028757355 7:94452912-94452934 CGTGTTGGGGGCACAGTGACAGG + Intergenic
1029607350 7:101606851-101606873 GGTGCTGGGGGCATAGCTGTGGG + Intergenic
1031074907 7:117202594-117202616 GGTGATGGGGACAAAATTGCGGG - Intronic
1031206064 7:118758832-118758854 TTTAATGTGGGCATAGTTACTGG + Intergenic
1031294377 7:119983495-119983517 GGTGGTGGGGGCATACTGGCAGG - Intergenic
1031546199 7:123053750-123053772 GGTGGTGGGGGGATGGTTTCTGG - Intergenic
1036275321 8:7346358-7346380 GGTGATGGGTTGATAGGTACAGG + Intergenic
1036528477 8:9556775-9556797 GGTGATGGGGGCGTGGTTGGGGG + Intronic
1036841360 8:12124746-12124768 GGTGATGGGTTGATAGGTACAGG - Intergenic
1038088708 8:24229564-24229586 GGTGATGGAGGCTTAGTTGAAGG + Intergenic
1038613015 8:29071372-29071394 GGCGATGGGGGGATGGGTACAGG + Intronic
1039739870 8:40372800-40372822 GGTGATGGGGGCATTCTTAGTGG - Intergenic
1041860211 8:62504212-62504234 GGTGGTGGGGGGACAGTTTCAGG - Intronic
1043747009 8:83887042-83887064 GGTAATGAGGGCATATATACTGG - Intergenic
1048449670 8:134522539-134522561 GGAGAGGGGAGCATAGTTAGGGG - Intronic
1052785288 9:32822607-32822629 GGTGATAGGGGGATGGGTACAGG - Intergenic
1052819686 9:33128967-33128989 GATGATGGGGTGATAGTTCCAGG - Intronic
1052869927 9:33494716-33494738 GATGATGTGTACATAGTTACAGG - Intergenic
1057688466 9:97260352-97260374 GATGATGTGTACATAGTTACAGG + Intergenic
1057909527 9:99006831-99006853 GGTGGTGAGGTCCTAGTTACTGG + Intronic
1057957594 9:99423974-99423996 GGGGATGGGGGCACAGTGAGAGG - Intergenic
1057957626 9:99424082-99424104 GGGGATGGGGGCAAAGTGAGAGG - Intergenic
1057957658 9:99424225-99424247 GGGGATGGGGGCACAGTGAGAGG - Intergenic
1057957740 9:99424548-99424570 GGGGATGGGGGCACAGTGAGAGG - Intergenic
1059827330 9:118045633-118045655 GGTGATGGGGGCATACTTGCTGG - Intergenic
1060795310 9:126508913-126508935 GGTGATGAGGGCAGAGTAAGTGG - Intergenic
1185620228 X:1449581-1449603 GGTGATGGTAGGGTAGTTACTGG - Intronic
1185620265 X:1449772-1449794 GGTGATGGGGGGATAGTTACTGG - Intronic
1185620277 X:1449834-1449856 GGTGATGTGGGGATAGTTACTGG - Intronic
1185620291 X:1449900-1449922 GGTGATGGTGGGATAGTTACTGG - Intronic
1185620321 X:1450044-1450066 GGTGATGGAAGGATAGTTACTGG - Intronic
1185620324 X:1450065-1450087 GGTGATGGGGGCATAGTTACTGG - Intronic
1185620332 X:1450104-1450126 GGTAATGGGGTGATAGTTACTGG - Intronic
1186671011 X:11767148-11767170 AGTGTTGGTGGCATAGTTCCAGG + Intronic
1188583080 X:31738950-31738972 GGTGGTGTAGGTATAGTTACTGG + Intronic
1188874465 X:35412897-35412919 GGTGATGGGTTGATAGGTACAGG + Intergenic
1189344206 X:40228175-40228197 GGTGGTGGGGGGATGGTTTCAGG + Intergenic
1194678258 X:96818895-96818917 GGGGATGTGGGGATCGTTACAGG + Intronic
1195547696 X:106131395-106131417 GGGGAGGTGGGCATAGTTAATGG + Intergenic
1199162922 X:144635254-144635276 GGGCAGGGGGGGATAGTTACTGG + Intergenic