ID: 1185625448

View in Genome Browser
Species Human (GRCh38)
Location X:1478179-1478201
Sequence TACAGAGAAATGCTTAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 233}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185625448_1185625452 11 Left 1185625448 X:1478179-1478201 CCAATCCTAAGCATTTCTCTGTA 0: 1
1: 0
2: 3
3: 17
4: 233
Right 1185625452 X:1478213-1478235 AATGCTTTTAAAATGAAAAATGG 0: 1
1: 0
2: 18
3: 156
4: 1409
1185625448_1185625453 17 Left 1185625448 X:1478179-1478201 CCAATCCTAAGCATTTCTCTGTA 0: 1
1: 0
2: 3
3: 17
4: 233
Right 1185625453 X:1478219-1478241 TTTAAAATGAAAAATGGTGCTGG 0: 1
1: 0
2: 2
3: 97
4: 824
1185625448_1185625454 21 Left 1185625448 X:1478179-1478201 CCAATCCTAAGCATTTCTCTGTA 0: 1
1: 0
2: 3
3: 17
4: 233
Right 1185625454 X:1478223-1478245 AAATGAAAAATGGTGCTGGCAGG 0: 1
1: 0
2: 3
3: 44
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185625448 Original CRISPR TACAGAGAAATGCTTAGGAT TGG (reversed) Intronic
901174468 1:7288889-7288911 TACAGAGAAATGCCTGAGATTGG + Intronic
901406540 1:9051116-9051138 TACAGACAATTGCTCAGGAGGGG - Intronic
903028562 1:20446689-20446711 TACAGAGAAAAGGGAAGGATTGG + Intergenic
903272852 1:22202468-22202490 TAAAGAAAAATGCTTGGGACTGG + Intergenic
903569902 1:24296698-24296720 TAAAGAGAAATCATTAGGCTGGG + Intergenic
904019930 1:27456025-27456047 AACAGTGAAAAGGTTAGGATGGG + Intronic
906867339 1:49436705-49436727 TTCACAGAAATTCTTAGGAAAGG + Intronic
907671790 1:56480848-56480870 GAAAGAGAAATGATTAGAATAGG + Intergenic
909908492 1:81229798-81229820 TAAAAAGATATGCTAAGGATTGG + Intergenic
910065010 1:83142049-83142071 TACAGAGAACTGCCTATGACTGG - Intergenic
911439865 1:97912432-97912454 TATAAAGAAATGCTTTTGATAGG + Intronic
915890906 1:159772882-159772904 TACAGAGAAATTAAGAGGATGGG - Intergenic
915934495 1:160082759-160082781 TACAGGGAAAGGTTTAGAATAGG - Intronic
918083709 1:181227251-181227273 TAAAAAAAAATGCTGAGGATGGG - Intergenic
918857176 1:189771924-189771946 TATAAAGAAATACTTAAGATTGG - Intergenic
921189605 1:212698482-212698504 AACAGCCTAATGCTTAGGATTGG + Intronic
921660838 1:217800446-217800468 TACAGAGGAATGCTAAGGGGAGG - Intronic
921711144 1:218374515-218374537 TACAGAGAACTGCTTCTGGTAGG - Intronic
922072211 1:222205741-222205763 TACAGTGTAATGATCAGGATTGG + Intergenic
922171009 1:223154796-223154818 TACAGTGAAATGCCAAGTATGGG - Intergenic
923541304 1:234890155-234890177 AACAGTGACAGGCTTAGGATGGG + Intergenic
924506147 1:244686202-244686224 TAAGAAGAAAAGCTTAGGATAGG + Intronic
1062947560 10:1472951-1472973 TAGATAGAAATGCTTGGGACTGG + Intronic
1063051185 10:2450550-2450572 AAAACAGAAATGCTTAGGATGGG - Intergenic
1063793638 10:9484740-9484762 TACAAAGAAATCTTTAGTATAGG + Intergenic
1066279065 10:33897428-33897450 CACAGGGAAATGCACAGGATAGG + Intergenic
1068103452 10:52584346-52584368 TACAGAGAAATCTTTGGGAAAGG + Intergenic
1068717213 10:60201579-60201601 TACAGAGCAATGTTTAGTGTGGG + Intronic
1070113584 10:73508010-73508032 TACAGAGTAATGTTTAGAATTGG + Intronic
1071461434 10:85900512-85900534 GACAGAAAAATGCTTGGGAAAGG - Intronic
1073873904 10:107899112-107899134 CACAGAAAAAAGCTTAGGATAGG - Intergenic
1075692303 10:124405776-124405798 TAGAGAGAAATGCCTAAAATAGG - Intronic
1076822957 10:132950560-132950582 CAGAAAGAAATGCTTAAGATCGG + Intergenic
1079381965 11:19946079-19946101 AACAGAGACATGCTCAGGTTAGG - Intronic
1080512304 11:32987230-32987252 TACAGAAAAATGATCAGCATTGG + Intronic
1080597959 11:33792335-33792357 TATAAAGAAATGCCTAGGACTGG - Intergenic
1080605150 11:33859440-33859462 TACACAGAAATGCTTCTGACAGG + Exonic
1081156776 11:39703005-39703027 CACAGAGAAATGCTTTGGGTGGG - Intergenic
1081530729 11:43957410-43957432 TATAAAGAAATGCTTAAGATAGG + Intergenic
1081607380 11:44535835-44535857 TACAAAAAAGTGCTTAGAATAGG + Intergenic
1082225018 11:49694851-49694873 CACAGTGAAATGCTTACTATAGG + Intergenic
1083717508 11:64586339-64586361 TGGAGAGAAATGCTTGGGTTTGG - Intergenic
1085487341 11:76876557-76876579 CATAGGTAAATGCTTAGGATTGG + Intronic
1085776701 11:79372994-79373016 GACAACGAAATGCTTAGGATAGG + Intronic
1086045837 11:82530344-82530366 TGCAACTAAATGCTTAGGATTGG + Intergenic
1088535301 11:110853787-110853809 TACAGAGAAATGCTTGCTTTGGG - Intergenic
1088812066 11:113398819-113398841 TAGAGAGCCATGCTTAGGAAAGG + Intronic
1089767050 11:120775596-120775618 TACAGTGTACTGATTAGGATGGG + Intronic
1090681463 11:129062837-129062859 TACAGAAAAGGGCCTAGGATGGG + Intronic
1094173870 12:27522372-27522394 TACAGAGAAATAATTAGAACTGG + Intergenic
1097071586 12:56359091-56359113 TAAAGAGAAATGCTTGGGGTGGG + Intronic
1097271616 12:57778605-57778627 GAGAGAGAAAAGCTTGGGATGGG - Intronic
1099813498 12:87616783-87616805 TAGAGAGATTTGGTTAGGATTGG - Intergenic
1100461337 12:94802530-94802552 TACAGTGAAATTCTCAGGAAGGG + Intergenic
1101182415 12:102233627-102233649 AACAGAGAAATCCCTAGGAGTGG + Intergenic
1101277797 12:103221652-103221674 TACAGAGAAAGGCATTGGTTTGG + Intergenic
1102183718 12:110932007-110932029 TACAGAGCAATTCCTAGGAAGGG + Intergenic
1102985134 12:117271856-117271878 TGCCGAGAAATGCTTAGAGTGGG + Intronic
1103133092 12:118485585-118485607 TACAGAGAAATGGCTGGGGTTGG + Intergenic
1104394707 12:128422649-128422671 TGAAGAGAGATGCTTAGCATAGG + Intronic
1105938727 13:25128128-25128150 TCCAGGGAACTGTTTAGGATTGG + Intergenic
1106491443 13:30227221-30227243 TTCAGAGAAATTCTTAAGTTTGG - Intronic
1106521590 13:30503035-30503057 AACAGATAAAAGTTTAGGATAGG + Intronic
1106650286 13:31682986-31683008 TACAGATTAATGCTTGGGAGAGG + Intergenic
1106946029 13:34828626-34828648 TACAGAGAAAGGTATAGGCTGGG - Intergenic
1107598888 13:41992357-41992379 GCCAGAGAAATGCTCAGGATTGG - Intergenic
1108746501 13:53400493-53400515 TACAGAAAAATGTGTAGGAGAGG + Intergenic
1109296529 13:60539150-60539172 TACAGAAAAACACTTAAGATAGG - Intronic
1111170840 13:84524231-84524253 TACAGAGAAGTCCTCAGGATTGG + Intergenic
1111627359 13:90806497-90806519 TACAGAGAGATTGTTAGCATGGG - Intergenic
1112384068 13:98921701-98921723 TCCACAGAAGTGCTCAGGATTGG + Intronic
1113829202 13:113281721-113281743 TAGAAAGAAATGCTTGAGATAGG + Intergenic
1114370939 14:22087339-22087361 TATAGATAAATACTTAGGAGTGG - Intergenic
1114414133 14:22528192-22528214 GGCAGAGAAATGGTTAGGTTTGG + Intergenic
1115893589 14:38059708-38059730 AACAGAAAAATGAGTAGGATAGG - Intergenic
1115970502 14:38939969-38939991 TACAGAGACATCCTGAGGTTTGG - Intergenic
1116714260 14:48407931-48407953 TACAGAGAACTGCCTAAGACTGG + Intergenic
1118141964 14:63093596-63093618 GCCAGAGAATTGCTTAGCATGGG + Intronic
1120216762 14:81688843-81688865 TGCAGAGAAAATATTAGGATGGG - Intergenic
1120406384 14:84098270-84098292 TGCAGAGATATGATAAGGATTGG + Intergenic
1121808376 14:96854367-96854389 TTCAGACATATGCTTTGGATGGG + Intronic
1122468367 14:101949445-101949467 TACAGGGAAAAGCTAAAGATGGG + Intergenic
1122985486 14:105209756-105209778 TACAGAGCTATGCTCAGGACGGG + Exonic
1123140229 14:106069651-106069673 TACAGAGATTTGCTTAAGTTTGG - Intergenic
1124009707 15:25828695-25828717 TACATGGAAATGCTTATGACTGG - Intronic
1124055464 15:26237578-26237600 TACACAAAAATGCTTGGAATAGG + Intergenic
1125233139 15:37481400-37481422 TACAGAGACATGTTTTGGAGGGG + Intergenic
1125258309 15:37792427-37792449 TACTGAGAAATACATAGGAAGGG + Intergenic
1126964595 15:54037073-54037095 CACACAGAAATACTTAGGACAGG - Intronic
1127013004 15:54650595-54650617 TACAGAGAAATACCTGAGATTGG + Intergenic
1127372184 15:58351812-58351834 GCCAGGGAAATGCTTATGATAGG - Intronic
1128366830 15:67010271-67010293 TACATATAAATTCCTAGGATGGG + Intergenic
1131016847 15:89064988-89065010 TACAGAGAAAAGCATGGGAATGG - Intergenic
1131103750 15:89715337-89715359 TCCAGAGAAATGCCTGGGAGTGG - Intronic
1133261124 16:4550974-4550996 TACAGAAAAGTGCTCAGGGTCGG + Intergenic
1133615899 16:7476711-7476733 TACAGAGCAATGCTTCAGAGGGG - Intronic
1134252655 16:12585414-12585436 CACTGAGAAATGCCTAGGACTGG + Intergenic
1137685225 16:50382119-50382141 TGCATAAAAATGCTTAGGACAGG + Intergenic
1138473372 16:57256261-57256283 TACAGAGAGAGGCTTGGGAAAGG + Exonic
1140281835 16:73562191-73562213 GACAGAGAAATTCCTAGGGTAGG - Intergenic
1146874355 17:36396455-36396477 TACAGTGAAATGATTAGGGCAGG + Intronic
1146881706 17:36447370-36447392 TACAGTGAAATGATTAGGGCAGG + Intergenic
1147065031 17:37916416-37916438 TACAGTGAAATGATTAGGGCAGG - Intergenic
1148929831 17:51119712-51119734 TACGGAGGAATGCTTTGGTTTGG + Intronic
1150776189 17:68083544-68083566 TCCAAATAAATGCTTAGGAAAGG - Intergenic
1152179939 17:78813116-78813138 TCCAGAGAAGTGGTTAGGACTGG - Intronic
1152532519 17:80927528-80927550 TACTTAAAAATGCTTAGGAAAGG - Intronic
1152790541 17:82276434-82276456 TATAAAGAAATACTTAGGACTGG - Intergenic
1155600622 18:27542443-27542465 TACAGTGAAATGCTTAAGTAAGG - Intergenic
1156149938 18:34228887-34228909 TACAGAGAAATGTTTGGGGGAGG + Intergenic
1156287149 18:35707944-35707966 TATAGAGTAATGCTTATTATTGG - Intronic
1156959357 18:43004617-43004639 TCCAGAGAAAAGATTAGTATAGG - Intronic
1157898764 18:51493326-51493348 TCAAGAGTAATGCTTAGGGTTGG - Intergenic
1158181049 18:54715207-54715229 TACAGAGAAATGCTTAATGGTGG + Intergenic
1158552375 18:58446900-58446922 TAAAGAGAATTGCTGAGGCTTGG - Intergenic
1159026468 18:63187015-63187037 AACAGGGAAATGCTTAAGGTTGG - Intronic
1159700422 18:71619629-71619651 TACACAGTAATTCTTATGATGGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161947368 19:7446066-7446088 AACAGAGAAATGCTTCAGTTTGG - Intronic
927840915 2:26443161-26443183 TTCAGAATAATGCTTAGGAGAGG + Intronic
928397885 2:30956999-30957021 CAGGGACAAATGCTTAGGATGGG - Intronic
928590910 2:32814114-32814136 TTCATAGAAATGCTTAGAGTTGG - Intronic
929099731 2:38300180-38300202 TAGAGAGAAATGCTGAAAATGGG - Intronic
931810238 2:65847745-65847767 AACAGAAAAATGCCTAGGAAAGG - Intergenic
932018832 2:68061971-68061993 TACAGAGAAATGTTTGTGTTTGG - Intronic
932783281 2:74577273-74577295 TTCTGAGGAATGCTTAGGCTAGG + Intronic
933464190 2:82630003-82630025 TACAAAGAAATACTTAAGACTGG - Intergenic
934045001 2:88165704-88165726 TACAGAGCAATGCTTAGCATGGG + Intergenic
935133894 2:100281769-100281791 TTCTGAGAAATCCTTAGAATTGG + Exonic
936887810 2:117334139-117334161 CACAGAGAAATTCTGAGGACAGG - Intergenic
937694576 2:124794070-124794092 TACATAGAAATGCTTTTGAAAGG - Intronic
940254553 2:151714932-151714954 TAGGGAGAAATGCTTGTGATTGG - Intronic
940716369 2:157229569-157229591 AACAAAGAAAAGCCTAGGATTGG - Intergenic
941947533 2:171116398-171116420 TACAAAGAAATGCTCAAAATAGG + Intronic
942161191 2:173189734-173189756 TACAGATTAATGGTTAGAATAGG - Intronic
942608362 2:177715354-177715376 CACAGAGATATGCTTTGGGTTGG + Intronic
943139105 2:183956448-183956470 AACAGAGAAAGCCTTAGGGTAGG - Intergenic
943216685 2:185045509-185045531 TACAGAGAAAAGCTAAGGAGAGG - Intergenic
943226199 2:185181497-185181519 TAAAGAGAATTGCTTAGGCTAGG + Intergenic
943288615 2:186039580-186039602 TACAAAATAATGCTAAGGATTGG + Intergenic
944270741 2:197783468-197783490 TACAGAGAAATGACTAGGGCAGG + Intronic
945617893 2:212096155-212096177 CACAGAGAAAAGCTCAGGTTTGG + Intronic
945988673 2:216374874-216374896 AACAGAGAACTGCTAAGGACAGG + Intergenic
948280876 2:236747200-236747222 TTCAGAGAAATGCTTAGGTGAGG - Intergenic
948576376 2:238953574-238953596 TATAGAGAAATGCAAAGGATGGG - Intergenic
1168807939 20:683808-683830 TTCAGAGACCTGCTTAAGATGGG - Intergenic
1174952681 20:55059960-55059982 TTCAGAGAAATCCTAAGGAAGGG - Intergenic
1175393036 20:58639182-58639204 TAGACAGAAATGCTGAGGCTTGG + Intergenic
1176686896 21:9857139-9857161 TGCAGAGAACTCCTTATGATAGG + Intergenic
1179034003 21:37744439-37744461 GACAGAGAAAAGCTCAGGTTAGG + Intronic
1182103174 22:27671569-27671591 GAGAGAGAAATGCTTAGCACAGG - Intergenic
1182103487 22:27673065-27673087 GAGAGAGAAATGCTTAGCACAGG - Intergenic
1183117565 22:35703457-35703479 TTCTGAGAAAGGCTTAGAATTGG + Intergenic
949782082 3:7701118-7701140 TCCTGAGACATGCTTGGGATTGG + Intronic
951135664 3:19102183-19102205 TACAGAGAAATGCTTAAAGGAGG - Intergenic
953499773 3:43421979-43422001 TGCAGGTAAATGCCTAGGATTGG - Intronic
955888767 3:63628286-63628308 TAAAGACAAATTCTTAGGACTGG + Intergenic
956912831 3:73837855-73837877 AACAAAGAAAAGCTCAGGATTGG + Intergenic
957765906 3:84623096-84623118 TACTGAGAAATGGTTATGGTTGG - Intergenic
960288734 3:115858998-115859020 TACACAAAAATGCTAAGGAAAGG + Intronic
961589671 3:127968004-127968026 TGCAGAGAAATGCTGAGCTTAGG - Intronic
962587441 3:136856683-136856705 TACAGAGAAATGTATAGAAGGGG - Intergenic
963655258 3:148040198-148040220 TAATGAGAAATCTTTAGGATGGG + Intergenic
964561064 3:157997101-157997123 TATAAAGAAATACTTAAGATGGG - Intergenic
965485652 3:169275158-169275180 TATGGAGAAATGCTTACCATAGG + Intronic
969140078 4:5062078-5062100 TACAGATAAATACTGAGGAGAGG - Intronic
972372780 4:38440984-38441006 TACAAAGAAATTTTTTGGATTGG - Intergenic
973202454 4:47519854-47519876 TACACAAAAATGATTAAGATAGG - Intronic
974873888 4:67678494-67678516 TACAGAAAAATGCCAAGCATGGG - Exonic
976672081 4:87665189-87665211 AACAGAGAAATGTGAAGGATGGG - Intergenic
977317195 4:95465190-95465212 GACAGAGGAATGCTGAGGAAGGG + Intronic
980350282 4:131675288-131675310 TGCAGAGAACTCCTTATGATGGG + Intergenic
980802863 4:137775362-137775384 CACAGAGGAAGGCTTAGAATGGG + Intergenic
981353467 4:143759299-143759321 TAAACAGAAATGCTTACGGTAGG - Intergenic
981624690 4:146742302-146742324 CACAGAGAAATGCTTGTGGTTGG - Intronic
985252756 4:188040605-188040627 TACAGAGAAATTTGTAGGCTGGG + Intergenic
986994072 5:13586238-13586260 TTCAGAGGACTACTTAGGATGGG - Intergenic
988629728 5:32916032-32916054 TACAGAGAAATGATTACAAATGG - Intergenic
988904383 5:35771214-35771236 TACAGAGAAATACCCTGGATTGG + Intronic
991319518 5:65355185-65355207 ATCAGAAAAATGTTTAGGATTGG - Intronic
992743238 5:79794642-79794664 TACAGGGAAGAGCTTAGGAACGG + Intronic
994265912 5:97716487-97716509 TACTAAAAAATGCTTAGGATGGG - Intergenic
995233248 5:109795284-109795306 TACATAGAAATGCTAAGGGTGGG - Intronic
995467988 5:112470461-112470483 TACATATAAATGTTTAGGACTGG - Intergenic
996062294 5:119045603-119045625 TACAGAGCAGTGGTTAGGCTTGG - Intronic
999525736 5:152404305-152404327 TTCAGAGAAAAACTTAGAATTGG - Intronic
1000912733 5:167041976-167041998 GACAGACAAATGCTAAGGCTGGG - Intergenic
1001265707 5:170273099-170273121 TACTGTAAAATGCTTATGATTGG + Intronic
1001819276 5:174696989-174697011 AACAGAGAAAGGTTTAGGCTGGG - Intergenic
1005132495 6:22525247-22525269 TACAAAGTTATGGTTAGGATTGG - Intergenic
1005797259 6:29378658-29378680 TACATAGAAATGCAAAGGAATGG + Intronic
1008194485 6:48501439-48501461 TACAGTGAAATGATTTTGATGGG - Intergenic
1010847708 6:80730967-80730989 AACATAGAAATGCTTAAGTTAGG - Intergenic
1012589523 6:100963026-100963048 GACAGGGAACTGATTAGGATTGG - Intergenic
1012636082 6:101543861-101543883 TACAGAGAAATGCTTAGTAAGGG + Intronic
1013592710 6:111632660-111632682 AACAGAGAAATGCTAAGGCCAGG + Intergenic
1014052436 6:116970934-116970956 TACAGAAAAATACTTATGTTTGG + Intergenic
1017575483 6:155797725-155797747 GACAGAGAAATGCTTCCGAAAGG + Intergenic
1017853097 6:158323070-158323092 TACAGTCACATGCTTAGGTTGGG - Intronic
1018785598 6:167105491-167105513 ACCAGAGAGATGCTCAGGATGGG - Intergenic
1019026915 6:168974059-168974081 TGCAGTGAAAGGCCTAGGATTGG - Intergenic
1023233331 7:38057223-38057245 TACAAAGAAAGGCTTAGACTGGG + Intergenic
1024587590 7:50855079-50855101 TTCAGAGAAATGCCTGGGCTCGG - Intergenic
1027184772 7:75964293-75964315 AAAAGAAAAATGCTTAGGCTGGG - Intronic
1027279097 7:76592700-76592722 TACAGAGAACTGCCTATGACTGG + Intergenic
1028326584 7:89534332-89534354 TACAGGGAAATGCTTAAAAGTGG + Intergenic
1030338709 7:108352944-108352966 TAGAGAGAAATGAATAGGTTTGG - Intronic
1033096049 7:138431929-138431951 TACAGAAAAATGTTCAGGGTTGG + Intergenic
1033635016 7:143204290-143204312 CAAAGAGAAATGCCCAGGATGGG + Intergenic
1037192640 8:16145912-16145934 TAAAGAGTAATACATAGGATAGG - Intronic
1038773623 8:30507848-30507870 CACATAAAAATGCTTAGGAGAGG - Intronic
1039823213 8:41152018-41152040 TGCAGAGAAAAGCTGATGATAGG - Intergenic
1041980131 8:63847946-63847968 TACAAACAAATGCTTATGTTGGG + Intergenic
1042422768 8:68611379-68611401 ATCAGAGAAATCCTTAGGCTTGG + Intronic
1042686547 8:71447960-71447982 TACAGAGAAATCTTTTGGAAAGG - Intronic
1043839600 8:85086939-85086961 GCCAGAGAAATGTTTAGCATTGG + Intergenic
1044177528 8:89146888-89146910 TAGAGAAAAATGCTAAGTATTGG + Intergenic
1044232572 8:89796394-89796416 TACTAAGAGATGCTTAGGACTGG + Intergenic
1047268858 8:123335339-123335361 TACAGGGAAATGCCTAGGGAAGG + Intronic
1047982907 8:130201705-130201727 AACAAAGAAATCCTTAGGATAGG - Intronic
1048261760 8:132951056-132951078 TACAGAGAAGTGGTTAAGAAAGG - Intronic
1048588247 8:135796091-135796113 GACAGAAAAATCCTTAAGATTGG + Intergenic
1048694302 8:137007593-137007615 TACAGAGAATTCCTGGGGATAGG + Intergenic
1050622699 9:7471296-7471318 TGCAGAGAAGTGCTTGGGAAAGG + Intergenic
1051469344 9:17419301-17419323 TATAGAATAATGCTTAGTATAGG - Intronic
1053782426 9:41624423-41624445 TGCAGAGAACTCCTTATGATAGG - Intergenic
1054170381 9:61834580-61834602 TGCAGAGAACTCCTTATGATAGG - Intergenic
1054667156 9:67746235-67746257 TGCAGAGAACTCCTTATGATAGG + Intergenic
1055979609 9:81989092-81989114 TACAGAGACATGTTTTAGATGGG + Intronic
1055993718 9:82134803-82134825 AACTGAGAAATGATTAGGCTGGG - Intergenic
1057105933 9:92417007-92417029 TGCAGACAAATGCTATGGATGGG - Exonic
1058774251 9:108268295-108268317 TGAAGAGAAAGGCTGAGGATGGG + Intergenic
1059588361 9:115630581-115630603 ATCAGAGAAAAGATTAGGATGGG + Intergenic
1059826582 9:118036311-118036333 TAAAGAGAAATGAGGAGGATAGG - Intergenic
1059875865 9:118634108-118634130 TATAGAAAAATGCTAATGATTGG - Intergenic
1059884971 9:118735830-118735852 TACAGAGAAATGCCTGAGACTGG - Intergenic
1185625448 X:1478179-1478201 TACAGAGAAATGCTTAGGATTGG - Intronic
1186809549 X:13174761-13174783 AACAGAAAACTGCTTAAGATAGG - Intergenic
1187408201 X:19023194-19023216 TACAGAGAAGTGTGTAGTATCGG - Intronic
1187982416 X:24772064-24772086 TACAGAGAAATGTTTATGATAGG - Intronic
1188377967 X:29456330-29456352 TACAGAGAGATGCATCGGGTAGG + Intronic
1188407493 X:29829682-29829704 TACAGTGTTATACTTAGGATTGG + Intronic
1188856480 X:35202291-35202313 TACAGAGACATGATGAGGAAGGG - Intergenic
1189719776 X:43904491-43904513 TACAGATTAATGCTAAGGACTGG + Intergenic
1190072459 X:47290607-47290629 TACAGAGAAATGGCTAGTGTTGG + Intergenic
1191143215 X:57136996-57137018 AACAGGGAAGTGGTTAGGATAGG - Exonic
1192346818 X:70316334-70316356 TAAAGAGAAATACTTTGAATAGG - Intronic
1192880563 X:75279029-75279051 TACAAACAACTGCTAAGGATGGG - Intronic
1193776797 X:85652186-85652208 TACAGAGTAATTTTTAAGATTGG - Intergenic
1194855023 X:98917851-98917873 TACAAAGAAATACTTGAGATTGG - Intergenic
1195345773 X:103949834-103949856 TACATAGAAATGCAAAGGACAGG + Intronic
1196067083 X:111475676-111475698 TACAGAGAAATCCTTTGTAAAGG - Intergenic
1199501568 X:148512847-148512869 TACCTACAAATGTTTAGGATAGG - Intronic
1199562016 X:149172974-149172996 CACAGAGAGATGGTTTGGATTGG - Intergenic