ID: 1185627030

View in Genome Browser
Species Human (GRCh38)
Location X:1489804-1489826
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 6, 1: 2, 2: 10, 3: 16, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185627023_1185627030 25 Left 1185627023 X:1489756-1489778 CCCCAGATTCACTTCTGCAAATG 0: 13
1: 3
2: 3
3: 28
4: 297
Right 1185627030 X:1489804-1489826 AGATATTCCCTGCAAATGTGGGG 0: 6
1: 2
2: 10
3: 16
4: 176
1185627024_1185627030 24 Left 1185627024 X:1489757-1489779 CCCAGATTCACTTCTGCAAATGT 0: 13
1: 5
2: 2
3: 13
4: 217
Right 1185627030 X:1489804-1489826 AGATATTCCCTGCAAATGTGGGG 0: 6
1: 2
2: 10
3: 16
4: 176
1185627025_1185627030 23 Left 1185627025 X:1489758-1489780 CCAGATTCACTTCTGCAAATGTA 0: 14
1: 2
2: 0
3: 15
4: 180
Right 1185627030 X:1489804-1489826 AGATATTCCCTGCAAATGTGGGG 0: 6
1: 2
2: 10
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910419106 1:87036804-87036826 AGGTTTTCCTTGAAAATGTGTGG - Intronic
913582910 1:120244847-120244869 GGAGGTTCCCTGTAAATGTGTGG + Intergenic
913625262 1:120653513-120653535 GGAGGTTCCCTGTAAATGTGTGG - Intergenic
914564841 1:148856343-148856365 GGAGGTTCCCTGTAAATGTGTGG + Intronic
914607985 1:149273899-149273921 GGAGGTTCCCTGTAAATGTGTGG - Intergenic
914983570 1:152437825-152437847 AAATATTCCCAGCAAATCTAAGG + Intergenic
915802512 1:158809206-158809228 GAATGTTCCCTGCAAGTGTGAGG + Intergenic
916359010 1:163946485-163946507 AGATCTTAACTGCCAATGTGCGG + Intergenic
917509740 1:175660325-175660347 AGCTATTCCCAGCCCATGTGCGG - Intronic
919062887 1:192656551-192656573 AGATATTCCTATCCAATGTGAGG - Intronic
919573473 1:199277498-199277520 AAATATTCACTGCATATGAGTGG + Intergenic
919900706 1:202042418-202042440 AGATATTCCCTGGGAATTCGAGG - Intergenic
921942009 1:220851858-220851880 ATATGTTAACTGCAAATGTGGGG + Intergenic
923904194 1:238364376-238364398 GGGTATTCCCTGTAAATGTATGG - Intergenic
924023082 1:239805150-239805172 ATTTAATCCCTGCAAATGGGAGG + Intronic
1062971585 10:1653067-1653089 AGAGCTTCCCTGCAAAAGGGTGG + Intronic
1064965217 10:21008835-21008857 ACATATTCCCTGCAAATAAGGGG + Intronic
1069119730 10:64555131-64555153 ACAATTTCCCTGCACATGTGAGG - Intergenic
1071895057 10:90057240-90057262 ACATGTTCCCTGAAAATCTGTGG + Intergenic
1074867000 10:117550528-117550550 AGACATTCCGTGCACGTGTGGGG + Intergenic
1076103259 10:127799308-127799330 AGATATCCCCTGAAAATGTGAGG - Intergenic
1077066272 11:642316-642338 GGGTATTCCCTGGAATTGTGGGG - Intergenic
1079523464 11:21356517-21356539 AAATATCTCCTGCAAATGGGGGG + Intronic
1079780135 11:24591866-24591888 AGATATTCACTGAAAATGTTTGG + Intronic
1080966619 11:37220396-37220418 TGCTTTTGCCTGCAAATGTGGGG + Intergenic
1082870588 11:57941158-57941180 AGATATTCTGTCCAAATGTGCGG - Intergenic
1083098223 11:60275128-60275150 AAATATTTCTTGCACATGTGAGG + Intergenic
1083220143 11:61247201-61247223 AGATGTTCGCAGCAAAGGTGGGG + Intronic
1084854865 11:71976722-71976744 ATATATTCCCTGGCAATTTGTGG + Intronic
1087247592 11:95857588-95857610 AAGTATTCCCTGAAAATGGGTGG - Exonic
1091346231 11:134856164-134856186 AGATAATCCCTACACATGGGTGG + Intergenic
1092673193 12:10886301-10886323 AGATATTGCCTGATGATGTGGGG + Intronic
1093246018 12:16737590-16737612 AGATATTTTCTAGAAATGTGTGG + Intergenic
1094818569 12:34208355-34208377 AGATATTCACTGCGAAAGTGAGG + Intergenic
1098975684 12:76899589-76899611 AGAAATTCCCTTAAAATGTGGGG - Intergenic
1099490882 12:83286578-83286600 AGCCATTTCCTTCAAATGTGGGG + Intergenic
1100670669 12:96809001-96809023 TTATTTTCCCTGAAAATGTGAGG + Intronic
1100855688 12:98755423-98755445 ATATTATCCCTGCAACTGTGGGG + Intronic
1106457738 13:29942234-29942256 AGACGTTGCCTGCAACTGTGAGG - Intergenic
1106602250 13:31198350-31198372 AAATATTCCTTGCATATGTGGGG - Intergenic
1107465862 13:40649738-40649760 ACATATACCCTCCAATTGTGAGG + Intronic
1112139855 13:96627408-96627430 AGATTTTACTTGCAAATGTTTGG + Intronic
1112361160 13:98719815-98719837 TGATTTCCCCTGCAAAGGTGGGG - Intronic
1115345109 14:32334673-32334695 ACATATTCCCTGATAATGAGGGG + Intronic
1116299533 14:43160047-43160069 AGATATTCTCTTTAAATGTCTGG + Intergenic
1117724524 14:58659924-58659946 AGATATGCCCTGAGAATGGGTGG - Intergenic
1118574746 14:67231094-67231116 AGATATCCCCTGAAGATGAGGGG + Intergenic
1202868032 14_GL000225v1_random:135741-135763 AGGTGTTCCCTGCAAAAGAGAGG + Intergenic
1126781773 15:52145052-52145074 AGATACTGGCTGCAAATTTGAGG - Intronic
1128287382 15:66448550-66448572 AAATTTTCCCTGGAAATGAGAGG - Intronic
1128716007 15:69908484-69908506 AGATATTTCCTGAAAAGATGAGG - Intergenic
1130934753 15:88459520-88459542 TGATATTACCTGCAAATGTGAGG + Exonic
1132316722 15:100895648-100895670 TGATATGCAGTGCAAATGTGTGG - Intronic
1133565032 16:6985251-6985273 ATATATTCCCTACCAATATGTGG - Intronic
1134867366 16:17620262-17620284 AGATTTTCCCTGCCAAGTTGAGG - Intergenic
1135773977 16:25240049-25240071 GGAGAATCCCTACAAATGTGTGG - Exonic
1138889656 16:61127451-61127473 ACATATCCCCTGCTAATGAGGGG - Intergenic
1139821659 16:69726153-69726175 AGAAATTCCCTCCAAAACTGTGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1155779960 18:29819151-29819173 AGGTTCTGCCTGCAAATGTGGGG + Intergenic
1157879803 18:51310482-51310504 AAATATTTCCTCCAATTGTGTGG - Intergenic
1159860839 18:73647489-73647511 AGATTTTGACTGCAAATGTAAGG - Intergenic
1160298984 18:77661756-77661778 AGAGAAGACCTGCAAATGTGTGG + Intergenic
1160413592 18:78691151-78691173 AAATGTTCCCTGAAAATGTATGG + Intergenic
1162102763 19:8349964-8349986 TGGTATTCCCTGCAAATTGGCGG + Intronic
1163868355 19:19794938-19794960 AGAGAAACCCTACAAATGTGAGG - Exonic
1164009187 19:21183323-21183345 AGAGAAACCCTACAAATGTGAGG + Exonic
1164029008 19:21383566-21383588 AGAGAAACCCTACAAATGTGAGG + Intergenic
1164029022 19:21383734-21383756 AGAGAAACCCTACAAATGTGAGG + Intergenic
1164067185 19:21726847-21726869 AGAGAAACCCTACAAATGTGAGG - Exonic
1164124595 19:22300849-22300871 AGGTTTTCCCTGCACATTTGTGG - Intronic
1164174299 19:22755774-22755796 AGATAAACCCTTCAAATGTGAGG - Intergenic
1164175775 19:22772860-22772882 AGGTGTTCCCTGCACATCTGTGG + Intronic
1164287532 19:23832875-23832897 AGAGAAACCCTACAAATGTGAGG + Intergenic
1166587950 19:43967819-43967841 AGATAATCCATACAAATGTGAGG + Intergenic
1168684343 19:58338894-58338916 AGAGAAACCCTACAAATGTGGGG + Exonic
926432611 2:12804339-12804361 AGATATTCCCTAGAAAGGAGTGG + Intergenic
926761119 2:16280048-16280070 AGATATTACCTACAAGGGTGGGG - Intergenic
927273349 2:21238482-21238504 AAATATTCCTTGCTTATGTGTGG + Intergenic
928228193 2:29473449-29473471 AGATATTTTCTCCAAATCTGTGG - Intronic
928797847 2:35045647-35045669 GTATATTCCCTTCAAAGGTGGGG + Intergenic
929493003 2:42413752-42413774 AGAAGTGCCCTGCAAAAGTGGGG + Intronic
929702066 2:44170890-44170912 AGATTATCCCTGAAAATGTGTGG - Intronic
929914525 2:46123311-46123333 AACTATTCCCTGCAATTGTGGGG + Intronic
933087647 2:78076048-78076070 AGATATTTTCTGCAAATATGTGG + Intergenic
940194240 2:151075595-151075617 AGTTATTGACTGTAAATGTGTGG - Intergenic
940321976 2:152387045-152387067 AGATATTTCATGAAAAAGTGTGG + Intronic
941765071 2:169287972-169287994 TGATATTCCTTAGAAATGTGAGG - Intronic
941891914 2:170591460-170591482 AGATTTTCTGTGAAAATGTGAGG + Intronic
942153559 2:173104013-173104035 AGAGTTTACCTTCAAATGTGGGG + Intronic
942814065 2:180031347-180031369 AGATATTCCATACAAATGGAAGG - Intergenic
945528352 2:210918582-210918604 ACATATTCCCTGCAGATAAGGGG - Intergenic
946616684 2:221517620-221517642 AAAAATGCCCTGCAACTGTGAGG - Intronic
948497284 2:238359747-238359769 ACATATCCCCTGCAAATAAGAGG - Intronic
1168862581 20:1056427-1056449 AGATCTAGCCTGCATATGTGTGG + Intergenic
1169973401 20:11296090-11296112 AGATATTTCTTACAAATATGTGG + Intergenic
1170350951 20:15440283-15440305 AGTTATTGGCTGTAAATGTGAGG + Intronic
1171114339 20:22511630-22511652 AGATATTTTCTGCATATGTCGGG - Intergenic
1171170129 20:23008374-23008396 AGATTTACCCTGGAAATGTAGGG - Intergenic
1171391847 20:24806626-24806648 AGATTGTCCCTGCACAGGTGAGG - Intergenic
1172344956 20:34190878-34190900 AGACATTCCCTGAAAAAGAGAGG - Intergenic
1173321273 20:41989349-41989371 AGATATTTTCTGCCAATCTGGGG + Intergenic
1174719437 20:52796265-52796287 ACATACTCCCTGCTAATGTTAGG - Intergenic
1175229693 20:57465882-57465904 AGATTTTCCCTGCATCTTTGTGG + Intergenic
1177687675 21:24460476-24460498 AGATATATCCTGCACTTGTGTGG - Intergenic
1180878868 22:19189631-19189653 AGAAAGTCACTGCAGATGTGGGG - Intronic
1180932424 22:19601590-19601612 AGAAAGTCACTGCAGATGTGGGG - Intergenic
1181397345 22:22631647-22631669 AGATAAGCCCTGCTAATGAGGGG + Intergenic
1181500095 22:23311022-23311044 AGATAAGCCCTGCTAATGAGGGG + Intronic
1181515917 22:23412816-23412838 AGAAAGTCACTGCAGATGTGGGG + Intergenic
1181652059 22:24264409-24264431 AGATAAGCCCTGCTAATGAGGGG - Intergenic
1181705317 22:24646334-24646356 AGATAAGCCCTGCTAATGAGGGG + Intergenic
949903552 3:8839536-8839558 AGTTACTCCCTGCAAATGCTGGG - Intronic
950406769 3:12809910-12809932 AGAGGTGCCCTGCAACTGTGAGG - Intronic
950970476 3:17181698-17181720 AGACATGCCCTGAAAATCTGTGG - Intronic
951256611 3:20457466-20457488 TGATCTTGCCTGCAACTGTGTGG + Intergenic
951523735 3:23632924-23632946 ACATTATCCCTGCATATGTGTGG + Intergenic
952708126 3:36400862-36400884 AGATATTCCCTTCATATGAAAGG + Intronic
952977420 3:38708098-38708120 AGTTAGTCCCTGCAAATGCTGGG + Intronic
952987634 3:38800442-38800464 TGAAATTCTCTGCAACTGTGAGG + Intergenic
955878738 3:63521802-63521824 AGAGATTCTCTGCAAATGTGTGG + Intronic
958076574 3:88689314-88689336 CTATATTTCCTGCAAATGGGAGG + Intergenic
960462139 3:117949202-117949224 AGATCTACCATGCAAATGGGGGG - Intergenic
964693320 3:159478377-159478399 GGCAATTCACTGCAAATGTGTGG + Intronic
966064394 3:175800319-175800341 ATATATTCCCTGAATATGGGAGG - Intronic
968150306 3:196332638-196332660 ACATATCCCCTGCAGATATGGGG - Intronic
971884162 4:32422308-32422330 ACATATTCCCTGCAGATAAGCGG + Intergenic
972845072 4:42978097-42978119 ATATGTTGGCTGCAAATGTGTGG + Intronic
973057553 4:45679546-45679568 AGACATTGCCTGCAGATGAGAGG - Intergenic
973071637 4:45867330-45867352 CGATATTCACTGCAAGTGTGGGG - Intergenic
973165681 4:47075039-47075061 GGATTTTCACTGCCAATGTGAGG + Intronic
974088242 4:57283670-57283692 ACATATTCCCCGCAAATAAGGGG - Intergenic
976911528 4:90313146-90313168 AAATTTTCCCTTCAAATATGAGG - Intronic
978977561 4:114896993-114897015 GGATAGTCTATGCAAATGTGGGG - Intronic
979711757 4:123788108-123788130 AATTATTCCCTGCTAATTTGGGG - Intergenic
980182100 4:129414059-129414081 AGATACTACTTGCAAAGGTGTGG + Intergenic
985513222 5:323544-323566 ATTTATTTCCTGCAACTGTGAGG + Intronic
986146850 5:5086062-5086084 TGATATTCCATTCAAATCTGTGG - Intergenic
988663971 5:33304684-33304706 AAATATCAACTGCAAATGTGGGG + Intergenic
992307506 5:75458309-75458331 AGTTATTCTTTGTAAATGTGAGG - Intronic
993968781 5:94390735-94390757 ATTTATTCCCTGAAAATGTATGG + Intronic
997925198 5:138024100-138024122 AAATATTCCCTTCACATCTGTGG + Intronic
1003349103 6:5298947-5298969 AGAAATTCCCTTCATATGTGAGG - Intronic
1005452689 6:25989317-25989339 AAACATTACCTGCCAATGTGTGG + Intergenic
1007345637 6:41227846-41227868 AGATGTTCCCTGGAAATGGTGGG - Intergenic
1009572990 6:65413498-65413520 AGATATTCCTTGCATCTTTGAGG - Intronic
1010288351 6:74106076-74106098 AGATATTTAGTGCAAGTGTGTGG + Intergenic
1011361083 6:86526192-86526214 AGATCATAGCTGCAAATGTGAGG - Intergenic
1014486300 6:122003382-122003404 TGATCTTCCCTGAACATGTGAGG - Intergenic
1015042458 6:128738616-128738638 ACATATTCCCTGCAGATAAGAGG - Intergenic
1015872837 6:137794455-137794477 AGATATTCCAGGCCAATGAGGGG - Intergenic
1016558370 6:145366721-145366743 AGATCTTGCCTGCCAATTTGTGG - Intergenic
1016670993 6:146707669-146707691 GGATATTCCGTGCAAATGTAAGG - Intronic
1018828892 6:167426971-167426993 AGCTATGCCCTGCAAATCTGTGG + Intergenic
1019960033 7:4451395-4451417 AGAAATGCCTTGCAAATGGGTGG + Intergenic
1025060282 7:55799555-55799577 AGATATTCCATGCAAATTATAGG + Intronic
1025767508 7:64469536-64469558 AGATAATTCCTACAAATGTGAGG + Intergenic
1025772269 7:64522030-64522052 AGAGAAACCCTACAAATGTGAGG - Exonic
1025822329 7:64978562-64978584 AGAGAAACCCTACAAATGTGAGG - Exonic
1025868041 7:65404578-65404600 AGATCTTTCCTGTAAATGGGAGG + Intergenic
1030414605 7:109226911-109226933 AGATTTTCCCTCCAATTCTGTGG - Intergenic
1034386525 7:150745194-150745216 ACATACTCCCTGCACATGTTTGG + Intronic
1035092811 7:156328598-156328620 CAATATTCCCTGAAATTGTGTGG - Intergenic
1035200071 7:157257297-157257319 AAATAGTCCCTCCAAATGTACGG - Intronic
1035734314 8:1876737-1876759 ACGTGTTCCCTGCACATGTGAGG + Intronic
1037185804 8:16061956-16061978 AGATATTCACTGCAAACCAGTGG - Intergenic
1038493358 8:27985367-27985389 AGAGATTCCCTGCCAAGGTTGGG + Intronic
1038771268 8:30483044-30483066 AGCTATTTCCAGCAACTGTGAGG + Intronic
1040546007 8:48398238-48398260 AGATCTTCCCTGACAATGGGAGG - Intergenic
1045695424 8:104803747-104803769 AAATTTTCACTCCAAATGTGTGG - Intronic
1048038514 8:130701495-130701517 ACATATTCCCTGCCAATAAGGGG + Intergenic
1048298113 8:133230277-133230299 AGAATTTCCCTGCAATGGTGTGG + Exonic
1048627172 8:136197939-136197961 TGGTATGCTCTGCAAATGTGAGG - Intergenic
1049440704 8:142608292-142608314 ACAGAGGCCCTGCAAATGTGGGG - Intergenic
1049969789 9:811815-811837 ATATTTTCTCTTCAAATGTGTGG - Intergenic
1050382991 9:5050657-5050679 AGATATTTCCTTCAAATTTTTGG + Intronic
1050496122 9:6244343-6244365 ACATATTTCCTGCAAATAAGAGG - Intronic
1050528971 9:6571239-6571261 AGATATTTCCTGCAGATAAGAGG - Intronic
1050701632 9:8346266-8346288 AAATAATCCCTGAAAATGTAAGG - Intronic
1052130648 9:24842394-24842416 AAATATTTCCTCCAAATCTGTGG + Intergenic
1052245317 9:26327273-26327295 AGATATTCAGTTCCAATGTGAGG + Intergenic
1061144513 9:128789665-128789687 AGATATTCCATACATATTTGTGG - Intronic
1185627017 X:1489716-1489738 AGATATTCCCCGCAAATGTGGGG + Intronic
1185627030 X:1489804-1489826 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627049 X:1489931-1489953 AGATATTCCCCACAAATGTGGGG + Intronic
1185627062 X:1490019-1490041 AGATATTCCCCACAAATGTGGGG + Intronic
1185627082 X:1490150-1490172 AGATATTCCCCACAAATGTGGGG + Intronic
1185627095 X:1490238-1490260 AGATATTCCCCACAAATGTGGGG + Intronic
1185627125 X:1490457-1490479 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627145 X:1490588-1490610 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627164 X:1490719-1490741 AGATATTCCCCACAAATGTGGGG + Intronic
1185627177 X:1490807-1490829 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627189 X:1490895-1490917 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627201 X:1490987-1491009 AGATATTCCCCACAAATGTGGGG + Intronic
1185627214 X:1491075-1491097 AGATATTCCCTGCAAATGTGGGG + Intronic
1185627233 X:1491206-1491228 AGATATTCACTGCAAATGTGGGG + Intronic
1185627243 X:1491294-1491316 AGATATTCCCCACAAATGTGGGG + Intronic
1185820355 X:3197196-3197218 AGATGCTCTCTGCAAATGTCAGG - Intergenic
1188070945 X:25717589-25717611 ATATATTTCCTGCATATGTAAGG - Intergenic
1188140939 X:26550253-26550275 AGATGTTGCCTTTAAATGTGAGG + Intergenic
1189009528 X:37032862-37032884 AGAGAAGTCCTGCAAATGTGAGG + Intergenic
1189039045 X:37522858-37522880 AGAGAAGTCCTGCAAATGTGAGG - Intronic
1189737189 X:44083569-44083591 ACATATCCCCTGCAAATAAGGGG + Intergenic
1192173175 X:68869383-68869405 AGATACTCACTGAACATGTGTGG + Intergenic
1192676752 X:73204340-73204362 AGAAAGTCACTGCAGATGTGAGG + Intergenic
1196650317 X:118161750-118161772 AGATATTCGCTGGAAAAGGGAGG - Intergenic
1198740608 X:139838343-139838365 AAATATTCACTGCAAATAAGGGG + Intronic
1200281762 X:154783026-154783048 AGACATTCCATGAAAATGAGAGG + Intronic
1202328150 Y:23714771-23714793 AGATATTTTCTGCAAGTGTTTGG - Intergenic
1202542620 Y:25955281-25955303 AGATATTTTCTGCAAGTGTTTGG + Intergenic