ID: 1185633378

View in Genome Browser
Species Human (GRCh38)
Location X:1534406-1534428
Sequence TGCCCCCAGGATCACCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185633378_1185633384 13 Left 1185633378 X:1534406-1534428 CCTTGGGGGTGATCCTGGGGGCA 0: 1
1: 0
2: 0
3: 21
4: 214
Right 1185633384 X:1534442-1534464 CGCCCTTTCCGTACCTTAACAGG 0: 1
1: 0
2: 0
3: 5
4: 22
1185633378_1185633387 19 Left 1185633378 X:1534406-1534428 CCTTGGGGGTGATCCTGGGGGCA 0: 1
1: 0
2: 0
3: 21
4: 214
Right 1185633387 X:1534448-1534470 TTCCGTACCTTAACAGGTGTAGG 0: 1
1: 0
2: 0
3: 5
4: 43
1185633378_1185633390 24 Left 1185633378 X:1534406-1534428 CCTTGGGGGTGATCCTGGGGGCA 0: 1
1: 0
2: 0
3: 21
4: 214
Right 1185633390 X:1534453-1534475 TACCTTAACAGGTGTAGGCAGGG 0: 1
1: 0
2: 1
3: 7
4: 85
1185633378_1185633389 23 Left 1185633378 X:1534406-1534428 CCTTGGGGGTGATCCTGGGGGCA 0: 1
1: 0
2: 0
3: 21
4: 214
Right 1185633389 X:1534452-1534474 GTACCTTAACAGGTGTAGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185633378 Original CRISPR TGCCCCCAGGATCACCCCCA AGG (reversed) Intronic
900146842 1:1162251-1162273 TGCCCCCAGTCCCACCCCAATGG - Intergenic
900598791 1:3494290-3494312 TGCTGCCTGGATCACCCACACGG + Intronic
901716234 1:11156895-11156917 AGATCCCAGGAGCACCCCCAAGG + Intronic
902507676 1:16948553-16948575 TGGCCCCAGGAGGACCCCCCAGG - Intronic
903849001 1:26295223-26295245 TTCCTCCAGGATGACCCACAAGG + Intronic
907307169 1:53519894-53519916 TGCTGCCAGGATCATCCGCAGGG - Intronic
907373490 1:54017836-54017858 TGCCCCGGGGCTCACTCCCAGGG - Intronic
909808817 1:79905806-79905828 TGCCCACAGGCTCAACACCAAGG + Intergenic
912475878 1:109934449-109934471 AGCCCACAGGTTGACCCCCATGG + Intergenic
912543917 1:110437454-110437476 TCCTCCCAGGATAGCCCCCAAGG + Intergenic
913326858 1:117635214-117635236 AGTCCCCAGGTGCACCCCCAAGG + Intergenic
915737573 1:158094635-158094657 TGCCCCCAGGACCCCACCAATGG + Exonic
917789805 1:178492325-178492347 TGCCCCCTGGCTGAACCCCATGG - Intergenic
918253265 1:182723690-182723712 AGCCTCCAAGATGACCCCCAAGG - Intergenic
919568443 1:199218417-199218439 TGCCCCTAGTTTCACTCCCACGG + Intergenic
919825446 1:201500223-201500245 GGCCCCTAGGAACACCCCTAAGG + Intronic
922161862 1:223084146-223084168 TTTCCCCAGCCTCACCCCCATGG + Intergenic
1065513996 10:26506683-26506705 ACCCCACAGGATCTCCCCCAGGG + Intronic
1066204986 10:33180229-33180251 AGCCCCCAGGAGGACCCCCAGGG + Exonic
1067229526 10:44396809-44396831 TGCCCCCAGCACGAGCCCCATGG - Intergenic
1067947812 10:50701455-50701477 AGCCCCCAGGATCCTCCTCAGGG + Intergenic
1069532614 10:69230323-69230345 GGCTCCCGGGCTCACCCCCAAGG - Intronic
1069883796 10:71610814-71610836 TGCCCCCAGGAAAACCAGCAGGG + Intronic
1070653484 10:78254667-78254689 TGGGCCCAGGACCACCCCCTAGG - Intergenic
1070883129 10:79866448-79866470 AGCCCCCAGGATCCTCCTCAGGG + Intergenic
1072521805 10:96236145-96236167 TGCCACCAGCATCTGCCCCAGGG - Intronic
1072652956 10:97309853-97309875 GGCCCCCAAGATCAGCCCCCTGG - Intergenic
1074080255 10:110162916-110162938 TGCCCTCTGCATCACCTCCAGGG - Intergenic
1075001983 10:118805406-118805428 TGCCCCCAGAATCACAGCCCAGG + Intergenic
1077032829 11:477407-477429 TGACCCCAGGGCCACCCCCCAGG - Intronic
1077215399 11:1393372-1393394 TGCCCCCAAGAACAGCTCCAAGG - Intronic
1077917186 11:6619004-6619026 TGCTCCTAGGATCCTCCCCAAGG - Intronic
1078501696 11:11885652-11885674 TGACCCCAGGATCCCCAACAAGG + Intronic
1082880047 11:58028214-58028236 TGCCCCCAGCATCTACCCCAGGG - Intronic
1083234231 11:61341643-61341665 AGTCCCCAGGAGCTCCCCCAGGG - Intronic
1083857408 11:65400008-65400030 AGGACCCAGGATCACCCTCAGGG - Intronic
1083924052 11:65795352-65795374 GGCTTCCAGGAGCACCCCCAGGG - Exonic
1084298058 11:68225970-68225992 TGCCCACAGCATCACCTCCTGGG - Intergenic
1084318965 11:68362889-68362911 TGCCCCCAGGCCCACCCTCAGGG + Intronic
1084367300 11:68710577-68710599 TGCTGCCAGGATCACCAGCAGGG - Intronic
1086945274 11:92838657-92838679 TGGCCTCAGAATCACCCCAAAGG + Intronic
1089758873 11:120708293-120708315 TGCCCCCACCACCACACCCAGGG - Intronic
1089847043 11:121466552-121466574 TGCCCCCATCCTCACCCCCAGGG - Intronic
1091281267 11:134383150-134383172 TGCCCCCAGGACCCATCCCATGG + Intronic
1091491530 12:936913-936935 TGCCCACAGGCACAACCCCACGG + Intronic
1091723917 12:2832870-2832892 TGCTGCCAGGAGCAACCCCAAGG - Intronic
1092029104 12:5269073-5269095 GGCCCCCAGGACCAGACCCATGG + Intergenic
1095976321 12:47943042-47943064 TGTCCCCAGGCTCACCGCCAAGG + Intronic
1096183522 12:49564338-49564360 AGGCCTCAGTATCACCCCCAAGG + Intronic
1096215459 12:49795676-49795698 TGCCCCCCGTATCCCCCCCTTGG + Exonic
1096607421 12:52776829-52776851 TTCCCCCAGGAAAGCCCCCAGGG + Exonic
1096610101 12:52795535-52795557 TTCCCCCAGGAAAGCCCCCAGGG + Exonic
1101664020 12:106793272-106793294 TGCCCCCAGCATCAGCACCAGGG + Intronic
1102504765 12:113376883-113376905 AGGCCCCAGCATCAGCCCCAGGG + Intronic
1103714328 12:122935220-122935242 GGCCCACAGGGTCACCCTCAGGG - Intronic
1104704565 12:130933695-130933717 TGTCCCCAGGATGACTCCCCAGG + Intergenic
1104971387 12:132532461-132532483 TGCCCCCAGTAGCACCCACTTGG + Intronic
1105277531 13:18944450-18944472 TGCACCCAGGGTCTCCCTCACGG - Intergenic
1107800240 13:44099636-44099658 TGCCCCCATGATCTCCCACCAGG + Intergenic
1107836707 13:44417598-44417620 TGCCTCCAGCATCACCCGAATGG + Intergenic
1109264923 13:60187064-60187086 AGCCCCTAGGATCATCCCTACGG - Intergenic
1109469567 13:62787920-62787942 TGCCTCCAGGATGACACCCAGGG - Intergenic
1109893712 13:68654655-68654677 GGCCCCCAAGATCAGCCCCCTGG + Intergenic
1111522933 13:89428463-89428485 TGGCCCCAGGATCCCCAGCAGGG - Intergenic
1114454636 14:22846864-22846886 GGCCTTCAGGCTCACCCCCAGGG - Exonic
1118742725 14:68752120-68752142 TTTCCCCAGGATCAGCCCGATGG + Intergenic
1118753232 14:68821301-68821323 TGCCACCAGGCTGGCCCCCAGGG - Intergenic
1119885394 14:78136378-78136400 TGGTTCCAGGACCACCCCCATGG - Intergenic
1121975958 14:98404382-98404404 TGTCCCCAGAAACACACCCAGGG - Intergenic
1122204098 14:100139766-100139788 TGTGCCCATGATCACACCCAGGG + Intronic
1122632402 14:103113002-103113024 TGCCCCCAAGCTCAGCCCCCAGG + Intergenic
1122771821 14:104101065-104101087 TGCGCCCAGGAGCTGCCCCACGG - Intronic
1122944270 14:104998803-104998825 TGCCCCCAGGAGCACCCTACTGG + Intronic
1125753576 15:42046985-42047007 TCCCTCCAGGACCACCCCTATGG - Intronic
1126175686 15:45733277-45733299 TGACCACAGGATCAGCCCAAGGG + Intergenic
1128087529 15:64896235-64896257 TGCCCCCAGCCTCAGCCTCATGG - Intronic
1128457873 15:67843039-67843061 GGGCCCCAGGATCAGCCCCCAGG + Intergenic
1129298604 15:74613027-74613049 TGGCCCCAGGGTCACCTCCCTGG - Intronic
1130974372 15:88762117-88762139 TGGCCTCAGGTTTACCCCCAAGG + Intergenic
1132031282 15:98440058-98440080 TTCCCCCAGGTCCACACCCATGG + Intronic
1132259091 15:100406210-100406232 TGACCCCAGGATCACCCTCTAGG + Intronic
1132789720 16:1678691-1678713 CGCCCCCAGGAAACCCCCCACGG - Intronic
1132997340 16:2830178-2830200 TTCCCCCAGGAAGAGCCCCACGG + Exonic
1133271699 16:4613700-4613722 CGACCCCAGGATTAACCCCATGG - Intronic
1137920267 16:52480150-52480172 TGGCCTCAGGATCAACCCCAGGG + Intronic
1138677849 16:58665078-58665100 TGTCCCCAGGATCAGACACAGGG + Intergenic
1139422421 16:66856846-66856868 TGTCCCCAGCATCACTTCCAGGG - Intronic
1140482275 16:75267929-75267951 TGCCCCCAGGCCCACACCCAAGG - Intronic
1142130989 16:88431370-88431392 TGCCCCCAGGACCACCCAGCAGG - Exonic
1142509475 17:385247-385269 TCCCCGCAGGACGACCCCCAAGG + Intronic
1142599929 17:1048670-1048692 TGCCGCCTGGATCACCTCCGGGG + Intronic
1143425795 17:6836399-6836421 TGCTCAAAGGATCACCCACATGG - Intergenic
1144094567 17:11888402-11888424 TAACCACAGGATCACCCCCCTGG + Intronic
1145041096 17:19579258-19579280 TGCCCCCAGGCCCAACCCCGAGG - Intergenic
1148755939 17:49972930-49972952 AGCCACCAGGATCGCCCCCTTGG - Intronic
1149850054 17:60028794-60028816 TGCCCCCAGCCTAGCCCCCACGG + Intergenic
1151215317 17:72573043-72573065 TCCCCCCAACATCAGCCCCAAGG - Intergenic
1152559111 17:81069023-81069045 TGCCACCGGGATCACCCCTGGGG - Intronic
1152564401 17:81093662-81093684 TGCCCCCAGGATCCCCCCTCCGG + Intronic
1152613675 17:81328410-81328432 TCTCCCCTGAATCACCCCCAGGG + Intronic
1152904795 17:82964611-82964633 TGCCTGCAGGTGCACCCCCACGG + Intronic
1152904956 17:82965098-82965120 TGCCTGCAGGTGCACCCCCATGG + Intronic
1153711154 18:7800376-7800398 TGCCCCCAGTATCATGCACAAGG - Intronic
1154009793 18:10564837-10564859 GGCCCCCAGGATGCACCCCAGGG + Intergenic
1160607071 18:80059307-80059329 TGCCCCCTGGAATCCCCCCAGGG + Intronic
1161959753 19:7516766-7516788 GGACCCCTGGATCACCTCCAGGG - Intronic
1162392438 19:10397739-10397761 TTGCCCCAGGATCACTGCCAAGG + Intronic
1162830804 19:13283091-13283113 TGCTCCCAAGAGCATCCCCAAGG + Intronic
1163214139 19:15863569-15863591 TGTCACCATGGTCACCCCCAGGG + Intergenic
1163238185 19:16041974-16041996 TGGCTCCAGAATCCCCCCCACGG + Intergenic
1163412336 19:17162939-17162961 TGCCCGCAGGTGCACCCCGAGGG - Intronic
1164745615 19:30610505-30610527 TCACCCCAGGATCAGCCCAATGG - Intronic
1165406094 19:35632275-35632297 TGCCCTCAGGAGGACACCCATGG + Intronic
1165743328 19:38216457-38216479 TGCCCCCAGCCTCAGCCCCAAGG + Intronic
1166223989 19:41383731-41383753 TGCCCCCTGGATGTCCCCCTTGG - Exonic
1166699888 19:44876219-44876241 TGCCCTCAGTAGCACACCCAGGG + Intronic
1166767323 19:45259341-45259363 TGTTCCCAGAACCACCCCCATGG + Intronic
1166801629 19:45461213-45461235 TGGCCCCAGGGACACCCCCTGGG - Intronic
1167269970 19:48501121-48501143 CTCCCACAGGGTCACCCCCAGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
926421283 2:12702188-12702210 TGCACCCCAGACCACCCCCAAGG + Intergenic
927256093 2:21042360-21042382 TGCCACCAGGATCAACTGCAAGG - Exonic
929561223 2:42957733-42957755 TGCCCTCAGGATCGCCACAAGGG - Intergenic
929563482 2:42970030-42970052 CGCCCACAGGATCACACCCTTGG - Intergenic
933976767 2:87518351-87518373 TACCCCCAGTCCCACCCCCAAGG - Intergenic
935268249 2:101412705-101412727 TGCTCCCAGGACCTACCCCAGGG - Intronic
936317048 2:111432453-111432475 TACCCCCAGTCCCACCCCCAAGG + Intergenic
941604927 2:167584972-167584994 TGCCCCCCGTCTCATCCCCAGGG + Intergenic
941713002 2:168734322-168734344 TGCCCTCAGAATCTGCCCCAGGG - Intronic
942188047 2:173443421-173443443 TGCCCCCAGGAACCTCTCCAAGG - Intergenic
946277889 2:218644472-218644494 TGCCACCCAGGTCACCCCCATGG + Exonic
946689284 2:222298603-222298625 TGCCCCCAGGATGACCACGCTGG - Exonic
948678124 2:239611055-239611077 TAACCCCAGGATCACCCACATGG + Intergenic
1169095202 20:2891737-2891759 TGATTCCAGGATCCCCCCCATGG + Intronic
1170802245 20:19600063-19600085 TTCCCTCAGAATGACCCCCACGG - Intronic
1172303009 20:33863044-33863066 TGCCCACAGGGACACCCCCATGG + Intergenic
1174197877 20:48786181-48786203 TGCCACCAGGACCCCTCCCAGGG - Intronic
1174297771 20:49561209-49561231 TGCCCCCAGTATAACCCAAAGGG + Intronic
1175193407 20:57226136-57226158 AGCCCTCAGGATCCACCCCATGG + Intronic
1176085499 20:63293840-63293862 TGACCCCAGTATCCCCACCAGGG - Intronic
1179035955 21:37759011-37759033 TGCCCTCAGTCTGACCCCCAAGG + Intronic
1179626094 21:42650360-42650382 TGCCCCCCACATCAGCCCCAGGG - Intergenic
1179713882 21:43277881-43277903 TATTCCCAGGAGCACCCCCAAGG + Intergenic
1179793146 21:43767199-43767221 TGGCCCCAAGTTCACACCCATGG + Intergenic
1180043718 21:45293266-45293288 TGCTCCCAGGGCCGCCCCCACGG - Intergenic
1181542876 22:23583332-23583354 TGCCCCCAGGGACACACCCGGGG - Intergenic
1181806376 22:25376843-25376865 TGCCCCCAGGCCCACCCTCAGGG - Intronic
1182257357 22:29048807-29048829 TGGTCCTAGGAACACCCCCATGG - Intronic
1183337079 22:37256062-37256084 TGAACACAGGATGACCCCCAAGG - Intergenic
1183458587 22:37936155-37936177 AACCCACAGGACCACCCCCAGGG - Intronic
949867175 3:8555513-8555535 TGCCCCCAGGCTCCTGCCCATGG - Intronic
950163449 3:10776637-10776659 TGCCCCCAGGAACTCCCCCTGGG + Intergenic
954613860 3:51959726-51959748 GGCCCCCACCATGACCCCCAGGG + Intronic
961407069 3:126687151-126687173 TGCCCCCATGACCACCCACTAGG + Intergenic
962955599 3:140263419-140263441 TGGCCACTGGCTCACCCCCATGG + Intronic
963975954 3:151480847-151480869 TGCCCCCAGCACCACAGCCAAGG + Intergenic
964432444 3:156621401-156621423 TGCCCACAGGGGCCCCCCCATGG + Intergenic
967155632 3:186689378-186689400 TGCCCTCAGGAACACAGCCAAGG + Intergenic
967297516 3:187979664-187979686 TGCCCCCAAAGTCACTCCCAGGG + Intergenic
968081961 3:195852768-195852790 TGCCCTCTGGATGACCCACAAGG + Intergenic
968886876 4:3339691-3339713 TGCCACAAGGATCAGCACCAAGG + Intronic
968930306 4:3575458-3575480 TGCCCCCAGCACCAGCCCCTGGG + Intergenic
969239400 4:5888892-5888914 TCCCTCCAGGATCGCGCCCAAGG + Intronic
969339759 4:6532767-6532789 TGCCACCACCATCACCCACATGG + Intronic
969343675 4:6558072-6558094 TGCCCCAAGTCTCACCGCCAGGG - Intronic
969672804 4:8598920-8598942 TGCCCCCAAGGACACCACCAGGG - Intronic
970878509 4:20900414-20900436 TGTCCCCAGCATCACGCACAAGG + Intronic
973891651 4:55373618-55373640 TGACCCAAGGAACAGCCCCATGG + Intergenic
975192486 4:71481375-71481397 TGGCCCCAGGAACTACCCCATGG - Intronic
976556154 4:86453390-86453412 TGCCCCCAGCAGCAGCACCAAGG - Intronic
979771196 4:124526691-124526713 TTGCCCCAAGGTCACCCCCAGGG - Intergenic
985662326 5:1163477-1163499 TGCCCCCAGGAAGTCCCCAAGGG - Intergenic
985670538 5:1204413-1204435 TGCCCCCAGCACCACCCTCGGGG - Intronic
996118226 5:119642614-119642636 AGCCCCCAAGATCACTCCCTTGG - Intergenic
1001584189 5:172821776-172821798 TGCCCTGAGCATCACCACCACGG + Intergenic
1001595738 5:172897609-172897631 TGAGCCCAGGAGAACCCCCACGG - Intronic
1002089330 5:176795152-176795174 CGCACACAGGATCTCCCCCAGGG - Intergenic
1002102143 5:176862920-176862942 TGCCCCCAGGATTCCCCACCTGG + Intronic
1002167484 5:177357559-177357581 TGTCCACAGGAACGCCCCCAGGG + Intergenic
1006636194 6:35462931-35462953 TGCCAGCAGGACCAGCCCCAAGG - Intronic
1007601743 6:43086346-43086368 GGCCCCCATAACCACCCCCAGGG - Intronic
1010028854 6:71251417-71251439 TGCCCCCAGGCTTAACCTCATGG + Intergenic
1013042853 6:106453783-106453805 TGCCCACAGGAGCAGCCCCAAGG + Intergenic
1013181549 6:107720820-107720842 TGGCAGCAGGACCACCCCCAAGG + Exonic
1013944281 6:115703933-115703955 AGACTCCAGTATCACCCCCATGG - Intergenic
1018837625 6:167497082-167497104 TGGCCCCAGAACAACCCCCAGGG - Intergenic
1019412493 7:912361-912383 TGTCACCAGGGTCACCCCCAGGG + Intronic
1019428783 7:989056-989078 AGCCCCCAGGAGCGCCTCCAGGG + Exonic
1019479459 7:1259931-1259953 TGCACCCAGGACCACCACGAGGG - Intergenic
1019534889 7:1523712-1523734 TGCCCACAGGCTCTCCCCCAGGG - Intergenic
1022467922 7:30663765-30663787 TCCCCACAGGCTCATCCCCAGGG + Intronic
1023661602 7:42476588-42476610 TGCACCCAGGCTCACACCCTGGG + Intergenic
1023870627 7:44261355-44261377 TGCCCCCCGCAGAACCCCCATGG + Intronic
1024291454 7:47807481-47807503 GGGCCCCAGGGCCACCCCCAGGG - Intronic
1024996364 7:55275759-55275781 AGCTTCCAGGATGACCCCCAGGG + Intergenic
1026143029 7:67722433-67722455 AGCCAGCAGGTTCACCCCCAAGG + Intergenic
1026325457 7:69305546-69305568 GGACCCCAGGACCTCCCCCAAGG - Intergenic
1026847481 7:73706031-73706053 TGTTGCCAGGAGCACCCCCAAGG - Intronic
1027440197 7:78211229-78211251 ACCCCCCAGGATCTGCCCCATGG + Intronic
1029438252 7:100574235-100574257 TGCCCCCACCTTCACCCCTAAGG + Intronic
1030896689 7:115069812-115069834 TACTCCCATGATCACCCCCCTGG + Intergenic
1031770206 7:125832596-125832618 GCCCCCCTGCATCACCCCCAGGG - Intergenic
1034164606 7:149015830-149015852 TGCCCCCCAGACCACACCCAGGG + Intronic
1035061164 7:156070690-156070712 CCCTCCCAGGATCACCCCCCAGG + Intergenic
1035263077 7:157674080-157674102 TGGCCCGAGGGTCACCCCTAAGG - Intronic
1035320281 7:158024638-158024660 TGCCCCACAGATCAGCCCCATGG - Intronic
1035608391 8:944609-944631 CACCCCCTGGATCACCCACATGG - Intergenic
1035608425 8:944768-944790 CACCCCCTGGATCACCCACATGG - Intergenic
1037582236 8:20252563-20252585 TGTCCCCACCATCACCCTCATGG - Intronic
1038352328 8:26788498-26788520 TGCCACCATCATCACCCTCATGG - Intronic
1038547566 8:28437417-28437439 TGCCCCCAGGATTCTTCCCAGGG + Intronic
1042215732 8:66428744-66428766 CGCCCCCTGGACCACCCCCTAGG + Intergenic
1044219309 8:89650254-89650276 TGCACCCAGAAACACCCACAGGG - Intergenic
1048169711 8:132094536-132094558 TGTCCCCAGGAACAACCACAGGG + Intronic
1048212421 8:132466466-132466488 TGCCCCCAGGAGCACCGCTTAGG + Intronic
1048318750 8:133382218-133382240 TGCCACCTGCATCAGCCCCATGG + Intergenic
1054459798 9:65456456-65456478 TGCCCCCAGCACCAGCCCCTGGG - Intergenic
1056009698 9:82314246-82314268 TGTCCCCAGCCCCACCCCCAGGG - Intergenic
1056575202 9:87851244-87851266 AGCCCCCAGGATCCTCCTCAGGG - Intergenic
1057886171 9:98831570-98831592 TGGCCCCCAGATCTCCCCCATGG + Intronic
1058862466 9:109129231-109129253 GGCCCCCAGGGTGAGCCCCAGGG + Intergenic
1059071458 9:111141788-111141810 TGTCCCCAAGACTACCCCCAAGG + Intergenic
1060235321 9:121858664-121858686 TGCCCCCAGGATTCTCCCCAAGG + Intronic
1061227290 9:129288142-129288164 TGGCCCCAGCACCTCCCCCATGG + Intergenic
1061563451 9:131421595-131421617 TGCCCCCAGCCTCACGGCCAGGG + Intronic
1061763754 9:132868685-132868707 ATCCTCCTGGATCACCCCCATGG + Intronic
1061844435 9:133379061-133379083 CACCACCAGGTTCACCCCCAAGG - Exonic
1062034447 9:134376695-134376717 TTCCCCCAGGAGCACAGCCAGGG - Intronic
1062517230 9:136942809-136942831 CGGCCCCAGGAACACCCCCGAGG + Exonic
1062656281 9:137605797-137605819 TGCCCCCAGGCGCACGCGCACGG - Exonic
1185633378 X:1534406-1534428 TGCCCCCAGGATCACCCCCAAGG - Intronic
1185670226 X:1803650-1803672 TGTCCCGAGGATCACCCCCTGGG + Intergenic
1193534076 X:82691275-82691297 TGAACCCAGGCTCACCCTCATGG - Intergenic
1193625905 X:83819660-83819682 TGGTCCCAGGATCCCCGCCAAGG - Intergenic
1195789065 X:108561319-108561341 AGCCCCATGGATCAGCCCCATGG + Intronic
1200152926 X:153960088-153960110 TGCCCCCCAGCTCACCTCCAGGG + Exonic