ID: 1185633859

View in Genome Browser
Species Human (GRCh38)
Location X:1537134-1537156
Sequence AAGGCGGCCGCTTCGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185633855_1185633859 -9 Left 1185633855 X:1537120-1537142 CCAGCAACCTTGCAAAGGCGGCC 0: 1
1: 0
2: 0
3: 2
4: 78
Right 1185633859 X:1537134-1537156 AAGGCGGCCGCTTCGCTGGGTGG 0: 1
1: 0
2: 1
3: 6
4: 56
1185633850_1185633859 9 Left 1185633850 X:1537102-1537124 CCTTCCAGTTCCATCTGTCCAGC 0: 1
1: 0
2: 0
3: 35
4: 314
Right 1185633859 X:1537134-1537156 AAGGCGGCCGCTTCGCTGGGTGG 0: 1
1: 0
2: 1
3: 6
4: 56
1185633849_1185633859 10 Left 1185633849 X:1537101-1537123 CCCTTCCAGTTCCATCTGTCCAG 0: 1
1: 1
2: 1
3: 23
4: 274
Right 1185633859 X:1537134-1537156 AAGGCGGCCGCTTCGCTGGGTGG 0: 1
1: 0
2: 1
3: 6
4: 56
1185633852_1185633859 -1 Left 1185633852 X:1537112-1537134 CCATCTGTCCAGCAACCTTGCAA 0: 1
1: 0
2: 2
3: 36
4: 289
Right 1185633859 X:1537134-1537156 AAGGCGGCCGCTTCGCTGGGTGG 0: 1
1: 0
2: 1
3: 6
4: 56
1185633851_1185633859 5 Left 1185633851 X:1537106-1537128 CCAGTTCCATCTGTCCAGCAACC 0: 1
1: 0
2: 1
3: 19
4: 137
Right 1185633859 X:1537134-1537156 AAGGCGGCCGCTTCGCTGGGTGG 0: 1
1: 0
2: 1
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185633859 Original CRISPR AAGGCGGCCGCTTCGCTGGG TGG Intergenic