ID: 1185637133

View in Genome Browser
Species Human (GRCh38)
Location X:1560970-1560992
Sequence CTTTGGAATGCTGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185637133_1185637138 11 Left 1185637133 X:1560970-1560992 CCATCCACCTCAGCATTCCAAAG No data
Right 1185637138 X:1561004-1561026 TAGGTGTGAGCCACTGTGACTGG 0: 13
1: 790
2: 9498
3: 34782
4: 84390
1185637133_1185637136 -8 Left 1185637133 X:1560970-1560992 CCATCCACCTCAGCATTCCAAAG No data
Right 1185637136 X:1560985-1561007 TTCCAAAGTGCTGCGATTATAGG 0: 12
1: 1497
2: 43729
3: 350994
4: 245549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185637133 Original CRISPR CTTTGGAATGCTGAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr