ID: 1185639018

View in Genome Browser
Species Human (GRCh38)
Location X:1576212-1576234
Sequence ACCCTCCACCTCCTACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185639016_1185639018 2 Left 1185639016 X:1576187-1576209 CCCTGGGATTCTCAATCTTTGCA No data
Right 1185639018 X:1576212-1576234 ACCCTCCACCTCCTACCTCAAGG No data
1185639017_1185639018 1 Left 1185639017 X:1576188-1576210 CCTGGGATTCTCAATCTTTGCAA No data
Right 1185639018 X:1576212-1576234 ACCCTCCACCTCCTACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185639018 Original CRISPR ACCCTCCACCTCCTACCTCA AGG Intergenic
No off target data available for this crispr