ID: 1185643077

View in Genome Browser
Species Human (GRCh38)
Location X:1599049-1599071
Sequence CTTTATCCCAAGGTGGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185643077_1185643081 5 Left 1185643077 X:1599049-1599071 CCGAGGTCCACCTTGGGATAAAG 0: 1
1: 0
2: 1
3: 9
4: 98
Right 1185643081 X:1599077-1599099 AATGCTTAATCGTTGGACCGTGG 0: 1
1: 0
2: 0
3: 0
4: 16
1185643077_1185643083 24 Left 1185643077 X:1599049-1599071 CCGAGGTCCACCTTGGGATAAAG 0: 1
1: 0
2: 1
3: 9
4: 98
Right 1185643083 X:1599096-1599118 GTGGCCTGTTCCGCCGTGTTTGG 0: 1
1: 0
2: 0
3: 2
4: 31
1185643077_1185643080 -2 Left 1185643077 X:1599049-1599071 CCGAGGTCCACCTTGGGATAAAG 0: 1
1: 0
2: 1
3: 9
4: 98
Right 1185643080 X:1599070-1599092 AGAGTTAAATGCTTAATCGTTGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185643077 Original CRISPR CTTTATCCCAAGGTGGACCT CGG (reversed) Intronic
911096802 1:94061689-94061711 CCTGATCCTAAAGTGGACCTGGG + Intronic
913541303 1:119823181-119823203 CTTTATCTCATGGAGGTCCTTGG + Intergenic
915104876 1:153527551-153527573 GTTTGTCCCATGGTGGGCCTGGG - Intergenic
916316257 1:163451506-163451528 CTTTCTCCCAATGTAGATCTAGG - Intergenic
920148153 1:203880767-203880789 CTTTATCTCAGGATGGCCCTGGG - Intergenic
924195220 1:241600193-241600215 CCTTATCCCAAAGAGGAACTGGG - Intronic
1063492876 10:6481180-6481202 CGGTATCCCAAGGTGCAGCTGGG - Intronic
1063794214 10:9492913-9492935 TTTTATGGCATGGTGGACCTGGG - Intergenic
1065770982 10:29078284-29078306 CTTAATCCCATGGTGGCCTTGGG - Intergenic
1068769903 10:60809549-60809571 CTTTGTCCCCAGGAGGCCCTGGG - Intergenic
1070749953 10:78958149-78958171 CTTCATCACATGGTGGTCCTGGG + Intergenic
1071033703 10:81216449-81216471 CCATTTCCCAAGGTGGAACTAGG - Intergenic
1072234769 10:93444090-93444112 CTTAAACCCAAGTTGGAACTAGG + Intronic
1074416073 10:113268025-113268047 CTTTTTTCCAAGGTGGGACTGGG + Intergenic
1079088602 11:17464912-17464934 CTCTATCCCTATGTGGGCCTGGG + Intronic
1079170740 11:18092942-18092964 TTTTATACCAAGGTTGACCATGG - Intronic
1081728282 11:45348752-45348774 TTTTATTCCAAGGTGCCCCTAGG + Intergenic
1086864108 11:91959419-91959441 CTTTATCCCACAGAGGACCTTGG + Intergenic
1091094334 11:132804717-132804739 GTGGATCCCAAGCTGGACCTTGG + Intronic
1093538182 12:20247920-20247942 GTTGATACCAAGGTGGATCTTGG + Intergenic
1098607774 12:72414299-72414321 ATTTATCCAAAGGTGTTCCTGGG - Intronic
1098910738 12:76205788-76205810 GTTTACCCCAAGGTAGAACTGGG + Intergenic
1100277828 12:93087390-93087412 CCTTAGCCCAAGGTGGACGAAGG + Intergenic
1107586875 13:41859125-41859147 CTTTATGCAACGTTGGACCTTGG - Intronic
1110256324 13:73437564-73437586 CTTTCTCCCAATCTAGACCTTGG - Intergenic
1110387569 13:74931808-74931830 CTTTACCCTAAGTTGGAGCTAGG - Intergenic
1117439551 14:55746837-55746859 CATTAACACAAGGTGGACTTTGG - Intergenic
1120176035 14:81294342-81294364 GTTTATGCCTAGGTTGACCTAGG - Intronic
1120312015 14:82841054-82841076 CTTTATCCCAAGAATGTCCTTGG + Intergenic
1121185950 14:91969588-91969610 CTTTATCACAAAGTGGCCTTTGG - Exonic
1122085594 14:99300094-99300116 ATTTATCACAAGGTGGCCATTGG + Intergenic
1127486398 15:59421635-59421657 CTTTTTCCCAAGAAGGACCAAGG - Intronic
1128684319 15:69672312-69672334 CTTTAGCCCCATGTGGACATTGG - Intergenic
1129437894 15:75556990-75557012 CTATATACCATGATGGACCTTGG - Intronic
1129727178 15:77907306-77907328 CTTTCTCCCAGGGTGGCCATGGG + Intergenic
1130172803 15:81533396-81533418 ATTTATCCCAAGGAGGATGTGGG - Intergenic
1133287452 16:4697220-4697242 CTCTACCCCAAGGCTGACCTCGG - Intronic
1133412234 16:5578426-5578448 CTGAATCCCAAGAAGGACCTTGG + Intergenic
1136272537 16:29157078-29157100 CTTTATCCCCAGGTGGTCCTCGG + Intergenic
1136655958 16:31709397-31709419 CTATATCCCTGGGTGGAGCTGGG + Intergenic
1138392641 16:56681872-56681894 TTTTATGCAAAGGAGGACCTGGG + Intronic
1141162670 16:81639641-81639663 CTTTATCCATTGGTGGACCTGGG + Intronic
1141774768 16:86115945-86115967 CTGTCACCCAAGGGGGACCTGGG + Intergenic
1142025482 16:87810625-87810647 CTGCAGCCCCAGGTGGACCTTGG + Intergenic
1142076094 16:88118887-88118909 CTTTATCCCCAGGTGGTCATCGG + Intergenic
1143599336 17:7933652-7933674 CTTGATCCCAAGAGGGAGCTAGG + Intronic
1145210776 17:21011481-21011503 CTGGCTCCCAAGGTGGCCCTGGG + Intronic
1147595241 17:41712518-41712540 CTTTATCCCAGGATGGAACTAGG + Intronic
1151455321 17:74222344-74222366 CTTGAACCCTAGGTGGAGCTTGG + Intronic
1152792633 17:82290114-82290136 CTTCACCCCAAGGTGAACATGGG - Intergenic
1203170689 17_GL000205v2_random:145848-145870 CTTTAAGCCAGGTTGGACCTGGG + Intergenic
1160230895 18:77048221-77048243 CTTTACCCGAAAGAGGACCTTGG + Intronic
1161761061 19:6173104-6173126 CTTTGTCCCAAGGGGGGCTTTGG + Intronic
1163950241 19:20577151-20577173 CTTTATCTCACAGTGGTCCTTGG - Intronic
1167645554 19:50703361-50703383 CTTTACCCCAAGGTGACACTAGG + Intronic
926856268 2:17259568-17259590 CTTAATCCCAAGGAGAGCCTGGG - Intergenic
932744054 2:74316971-74316993 CTCCATCCCAAGGTGAACATGGG + Intronic
936282517 2:111154669-111154691 CTTTGATCCAAGGTGGATCTTGG + Intronic
944646355 2:201784515-201784537 CTCTATCCCAAAGTGAACATGGG - Intergenic
1169026623 20:2377047-2377069 CTTCATGCCATGGTGGACTTGGG + Intergenic
1170070250 20:12358492-12358514 CTTTTACCCAAGGTGGCCTTTGG - Intergenic
1170481880 20:16774245-16774267 CAGTATCCCAAGCTGTACCTGGG - Intergenic
1174580014 20:51564628-51564650 CTTCCACCCAAGGTGGAACTTGG + Intergenic
1183250702 22:36728528-36728550 CTTGATAGCAAGGTGGACCTTGG + Intergenic
1183335465 22:37243727-37243749 CTTTGTCCCCAGGCTGACCTGGG - Intronic
949329753 3:2908584-2908606 CATTATCTCAAGGTGGAAATGGG - Intronic
949714634 3:6915350-6915372 TTTTATCCCATGTTGTACCTTGG + Intronic
953208245 3:40851192-40851214 CTTTATTCTCAGCTGGACCTAGG + Intergenic
954717046 3:52532102-52532124 CATTAGCCCAAAGCGGACCTCGG + Intronic
956264553 3:67382336-67382358 CTTTACCCTCAGGTGAACCTGGG - Intronic
956695566 3:71916384-71916406 TTTTCTCCCAAGGTTGACATGGG - Intergenic
966202379 3:177370478-177370500 CTCTATCCCAAAGTGTAACTTGG + Intergenic
969082840 4:4633174-4633196 CCTTGGCCCAAGGTGGACCTAGG + Intergenic
970184075 4:13430862-13430884 CTTTGTCCCAAGGTGGGTTTTGG - Intronic
976939935 4:90687543-90687565 CTTTATCTCAAGGCAGGCCTGGG - Intronic
977176312 4:93824609-93824631 CTCTATTCCAAGGTGAACCAAGG - Intergenic
980397418 4:132232508-132232530 CTTATTCCCATGGTGGACCATGG + Intergenic
986864628 5:11972091-11972113 CTTTATCCCCATGTCCACCTAGG + Intergenic
987247091 5:16060065-16060087 ATTTAACGCAAGGAGGACCTTGG - Intergenic
988652479 5:33167400-33167422 CTTTATCTCAAGGTGTCCTTGGG - Intergenic
992747872 5:79836778-79836800 CTCCATCCCAAGGTGAACATGGG - Intergenic
995848322 5:116518246-116518268 CTTTCTCCCAAAGTGGACACTGG + Intronic
999310252 5:150547256-150547278 CATTCTCCCCAGGAGGACCTGGG + Intronic
1000345358 5:160309809-160309831 CTTTAAGTCAAGGTTGACCTTGG + Intronic
1005154091 6:22783898-22783920 CTTTATGCCAAGGTAGATTTTGG + Intergenic
1009402127 6:63269505-63269527 CTTTATCCAATGATGGACCTAGG - Intergenic
1010915944 6:81619025-81619047 CTTTATCCCATGCAGCACCTTGG - Intronic
1013111932 6:107071036-107071058 CATGCTCCCAAGGTTGACCTCGG - Intronic
1013260223 6:108434175-108434197 CTCCATCCCAAGGTGAACATGGG - Intronic
1013470644 6:110460884-110460906 CTTTGTCCCAAGGAGCACTTTGG - Intronic
1016680836 6:146827809-146827831 CATTCTCAGAAGGTGGACCTGGG - Intergenic
1021399676 7:20195545-20195567 CTTTACCCCAAGGTAAACATGGG - Intronic
1022598232 7:31732801-31732823 CTGTAACCCAAGGGGGACCTCGG + Intergenic
1023067566 7:36393565-36393587 CTTCATCCCAAAGTGAACATGGG - Intronic
1024594745 7:50922650-50922672 CTTTGTCACATGGTGGATCTGGG + Intergenic
1034040566 7:147873125-147873147 CTTGATCCCAAGCTGGAGCGTGG - Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034625857 7:152491843-152491865 CTTTCTTCCAAGGTGTCCCTGGG + Intergenic
1035172164 7:157022807-157022829 CATTTTCCCAGGGTGGACCAGGG - Intergenic
1039819352 8:41122441-41122463 CTCTATCCAAAGGTGGAACAAGG - Intergenic
1043662214 8:82758144-82758166 CTGTATCCCAAGGTGGAAGCAGG - Intergenic
1044121066 8:88396576-88396598 CTTTTACCCATGGTGGATCTAGG + Intergenic
1047988634 8:130262637-130262659 CTTTATCCCAACATGGATCATGG - Intronic
1057000064 9:91500403-91500425 CTCTATCCCAAGATGAACATGGG - Intergenic
1059562034 9:115345310-115345332 CCTCTTCCCAAGGTGCACCTAGG + Intronic
1185643077 X:1599049-1599071 CTTTATCCCAAGGTGGACCTCGG - Intronic
1196372908 X:114998825-114998847 CTTTGTCCCAAGGGGGACTTTGG - Intergenic
1197200267 X:123742587-123742609 CTCTATCCCAAAGTGAACATGGG + Intergenic
1198617449 X:138474899-138474921 CTTTACCCTAAGGTGAACATGGG - Intergenic