ID: 1185648923

View in Genome Browser
Species Human (GRCh38)
Location X:1634603-1634625
Sequence TCCTCTCTTTAGAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 260}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185648918_1185648923 28 Left 1185648918 X:1634552-1634574 CCTTGTGAGGTAGGACATTCTTA 0: 1
1: 0
2: 2
3: 16
4: 236
Right 1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 260
1185648919_1185648923 -8 Left 1185648919 X:1634588-1634610 CCAATTAAGTGCCAATCCTCTCT 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 260
1185648917_1185648923 29 Left 1185648917 X:1634551-1634573 CCCTTGTGAGGTAGGACATTCTT 0: 1
1: 0
2: 0
3: 12
4: 112
Right 1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG 0: 1
1: 0
2: 4
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185648923 Original CRISPR TCCTCTCTTTAGAATGTGGA GGG Intronic
901358580 1:8675142-8675164 TAGTCACTTTAGAATGTGCAAGG - Intronic
901720355 1:11192445-11192467 TCCTTTCTTTAAACTGTGAATGG - Intronic
902721267 1:18305839-18305861 TCCTTTCTGTAAAATGAGGACGG - Intronic
902739143 1:18422588-18422610 TCCTTTTTTTCGAATGTGTAAGG - Intergenic
902992313 1:20196938-20196960 TCCTCCCGTTAGTATGTGGGAGG - Intergenic
905011680 1:34751380-34751402 TCCTTTCTTTCGAATGTGGAAGG - Intronic
908637143 1:66179952-66179974 TCCTTTCTATAGAATAGGGATGG - Intronic
909206880 1:72769801-72769823 GCCTTTCTTTGGAATGTGTAAGG - Intergenic
910034330 1:82772450-82772472 TGCTCTTTGTACAATGTGGATGG - Intergenic
912994286 1:114517660-114517682 ACCTTTCTTTGGAATGTGCAAGG + Intergenic
913218032 1:116636767-116636789 TGCTGTCTTTGGAGTGTGGAAGG - Intronic
914220008 1:145672774-145672796 TTCCTTCTTTAGAATCTGGAGGG + Exonic
914472588 1:147995640-147995662 TTCCTTCTTTAGAATCTGGAGGG + Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
915145340 1:153793376-153793398 TCTTCTCTTTAGGATGGGGCTGG + Intergenic
915930866 1:160060179-160060201 TCCTCCCTTAAGAAGGAGGATGG + Intronic
916677241 1:167074339-167074361 ACCTCCCTTCAGAATGTTGATGG - Intronic
917195343 1:172458250-172458272 TTCTTTCTTTCTAATGTGGATGG - Intronic
917447673 1:175120446-175120468 TCCTCTCTGTAGAATGTCCAGGG + Intronic
921377787 1:214492027-214492049 TCCTCTATTTGAAATGAGGATGG - Intronic
922548976 1:226480073-226480095 CCCTCCCTTTAGAATGTTGAAGG + Intergenic
923100183 1:230807991-230808013 CTCTCTTTTTAGAATGTAGAGGG - Intergenic
923100300 1:230809073-230809095 CTCTCTTTTTAGAATGTAGAAGG - Intergenic
923956669 1:239030372-239030394 TCATCTCTTTAGGATTGGGAGGG + Intergenic
923969619 1:239185289-239185311 TCATCTTTTTATAAGGTGGATGG + Intergenic
924578824 1:245305082-245305104 TCCTCTCTCTAGCATGGGGGTGG - Intronic
1065922154 10:30402266-30402288 TCCTTTTTTTGGAATGTGCAGGG + Intergenic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1071286880 10:84157016-84157038 AGCTCTCTGTAGAAGGTGGAAGG - Intergenic
1071306234 10:84301086-84301108 TCCTATATTTAAAATGAGGATGG - Intergenic
1071507208 10:86240031-86240053 CCCTCTCCTTAGATTGTAGATGG - Intronic
1075488858 10:122849007-122849029 TACTCACTTTGGAATGTGGGGGG - Intronic
1077691137 11:4343699-4343721 TCATCTCCTGAGAATGGGGAAGG - Intergenic
1077812065 11:5648169-5648191 TCTTCTTCCTAGAATGTGGATGG - Intergenic
1079232141 11:18657867-18657889 TCCTCTCTTTAGACTATATAGGG + Intergenic
1080992720 11:37558883-37558905 TCCTCTCTTTCAATTGTGAAAGG + Intergenic
1081134210 11:39418252-39418274 TCCTGTGTTTAGAATCTAGAAGG - Intergenic
1083573598 11:63773191-63773213 TGCTCTCTGGAGAATGTTGAAGG - Intergenic
1083690665 11:64406619-64406641 TCCTCTCTTTGGAATGTGCAGGG - Intergenic
1087274148 11:96143723-96143745 CAATCTCTTTAGAATGTGGAAGG + Intronic
1087873660 11:103329397-103329419 TCATCTCTGTAGAATGTTGGAGG + Intronic
1088992116 11:114962681-114962703 TCCTCTCTTAGGAATCTGCAGGG + Intergenic
1091209114 11:133841832-133841854 GCCTCTCTTAAGTTTGTGGAAGG - Intronic
1092274150 12:7046604-7046626 TCCTCACTGTATAGTGTGGAAGG + Intronic
1094407520 12:30133743-30133765 TCCAGTGTTTAGAATGTGCATGG - Intergenic
1096429230 12:51529709-51529731 TCCTTTCTTTGGAATGTGCAAGG - Intergenic
1096770414 12:53932694-53932716 CCCTCTCTTTTGGAAGTGGAGGG + Intergenic
1096888780 12:54744833-54744855 TCCTTTGTTTGGAATGTGCAGGG + Intergenic
1097318507 12:58199699-58199721 GCTTCTCTTTTGAATGGGGAGGG - Intergenic
1097795433 12:63856378-63856400 TCCTGACTTTAGAGTGGGGAAGG - Intronic
1099434288 12:82625116-82625138 CCCTCTCTATAGAATGTCAAGGG + Intergenic
1100941423 12:99726547-99726569 TCCTCTTTGTAGAATTTGGCTGG - Intronic
1102673700 12:114641787-114641809 TCCTCTGTATCAAATGTGGATGG + Intergenic
1103967440 12:124648871-124648893 TCTTTTCTTTGGAATGTGCAGGG - Intergenic
1104146022 12:126034654-126034676 TCCATCCTTTTGAATGTGGAGGG + Intergenic
1107325426 13:39236947-39236969 TCCTCCCTTGGAAATGTGGAGGG + Intergenic
1107398777 13:40048145-40048167 CCCTCCCTTGAGAATGGGGATGG + Intergenic
1109031362 13:57193876-57193898 TCCTATCTTTAGAAGGTCGCTGG - Intergenic
1109149507 13:58827502-58827524 TTATCTCTTTAGAATTTTGATGG - Intergenic
1112929583 13:104717565-104717587 TTCTCTCTTTAGTTTGGGGAGGG + Intergenic
1113191571 13:107753964-107753986 ACCTCTTTTTAGCACGTGGATGG - Intronic
1114539897 14:23447195-23447217 TCTTATCTGTAAAATGTGGATGG + Intergenic
1115776188 14:36717851-36717873 TCCTCTCTTTATAAGGTTGATGG - Intronic
1115890449 14:38021553-38021575 TCTTGTCTCTAAAATGTGGATGG + Intronic
1116330415 14:43589853-43589875 TCATCTATTTAGAATGAGGCAGG - Intergenic
1116607566 14:47021287-47021309 GCTTCTGTTTAGAATGAGGATGG - Intronic
1116715323 14:48418636-48418658 TCCACTCTTGTGAAGGTGGAAGG + Intergenic
1116825604 14:49670527-49670549 TCCTATCTATAGAAGGGGGAAGG - Intronic
1117925824 14:60778214-60778236 TACTCTTGTTAGAATGGGGAGGG + Intronic
1119774282 14:77238907-77238929 TCAGCTTTTTAGAATGGGGAGGG + Intronic
1121319856 14:92985894-92985916 TCCTATCTGTAAAATGGGGAGGG - Intronic
1122609721 14:102973685-102973707 TCCTCGCTTTAGAATGCAGTGGG + Intronic
1122835492 14:104428697-104428719 TCCTCTCTATAAAATGGGAAGGG + Intergenic
1124165091 15:27319269-27319291 TGCTCTCTTGATGATGTGGATGG + Intronic
1125295184 15:38195125-38195147 TACTCTGTTTATAATGTGGCTGG - Intergenic
1126283967 15:46989575-46989597 TCATGTCTTTAGAATCTGCAGGG - Intergenic
1126850520 15:52794377-52794399 TCTTCTCTTTGGGATATGGAAGG - Intergenic
1129779381 15:78260125-78260147 GCCTGTCTTTAGGAAGTGGAAGG - Intergenic
1129834526 15:78693710-78693732 TCCTCTTTTTGGAATGTGCAGGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131885236 15:96905208-96905230 TCATTTCTCTAGAATGTAGATGG + Intergenic
1132139919 15:99383821-99383843 TCCTCCCTCTAGAATCTGCAAGG + Intronic
1135767709 16:25192232-25192254 GCCTCTCTTGAGCATGTGGCTGG - Intergenic
1135826325 16:25731715-25731737 TCCTTTCTTTGGAATGTGGAGGG + Intronic
1137006278 16:35276663-35276685 TCCTTTGTTTAGAAAGGGGAGGG + Intergenic
1138835629 16:60431105-60431127 TCCTATCTGTAAAATGAGGAAGG - Intergenic
1139843462 16:69901378-69901400 TCTTTTCTTTAGGATGTGAAAGG + Intronic
1140764179 16:78140490-78140512 TACTCCCTTTAAAATGTGTAGGG + Intronic
1143566808 17:7727041-7727063 TCCTCACTTGTGATTGTGGATGG + Intronic
1144360117 17:14484167-14484189 TCCTCTCTTTACCAGGAGGAAGG + Intergenic
1148904028 17:50900219-50900241 TCCTCTCTTTAGAAAGAAAAAGG + Intergenic
1150346727 17:64410505-64410527 ATTGCTCTTTAGAATGTGGAAGG + Intronic
1150655898 17:67039212-67039234 TTCTTTCTTTGGAATGTGTAGGG + Intergenic
1151044637 17:70904828-70904850 TCCTCCATTTAGTATGAGGATGG + Intergenic
1154306667 18:13235593-13235615 ACCACTATTTAGAATGTGGGGGG - Intronic
1155126578 18:22883270-22883292 TACTCTCTAGAGAATGAGGAGGG - Intronic
1155194235 18:23458285-23458307 TCATATCTTTAGGAAGTGGAAGG + Intronic
1156912927 18:42432253-42432275 TTTGCTCTTTAGTATGTGGAGGG + Intergenic
1157380256 18:47208073-47208095 TCTTATCTATAAAATGTGGATGG - Intergenic
1157754859 18:50208572-50208594 TCCTTTCTTTGGAATGTGCAGGG + Intergenic
1158080444 18:53583728-53583750 ACTTCTCTTTCGAATATGGAAGG + Intergenic
1158677539 18:59534850-59534872 TGCTCTCTTGAGCATGAGGAGGG + Intronic
1159038470 18:63299764-63299786 TGCTCTCTGGAGAATGTGAAAGG - Intronic
1159152662 18:64539918-64539940 TCCTCTTTTTAAAATATGTAGGG + Intergenic
1159653527 18:71004928-71004950 TAATCTCTTTAGGATTTGGAGGG + Intergenic
1164379660 19:27720875-27720897 CCCTCTCATTAGAATGTTGGAGG + Intergenic
1164423438 19:28118294-28118316 TCCACTCTTTAGTTTGTGGAGGG - Intergenic
1164492697 19:28729146-28729168 TCCTTTCTTTAGGATATGGAGGG - Intergenic
1167242895 19:48355703-48355725 TCCTTTCTTTGGAATGTGCGGGG - Intronic
1167828507 19:51997594-51997616 TTCTTTCTTTGGAATGTGTAGGG - Intronic
1168141366 19:54389678-54389700 TCCTTTCCTAAGAATGAGGAAGG + Intergenic
925929792 2:8697827-8697849 TCCTCACTTTAAAAAGTGGCAGG - Intergenic
927011410 2:18908427-18908449 TCCTTTCTTTAGAATAGGGCTGG + Intergenic
927286249 2:21360101-21360123 TCCTCTCTTTGGAATGGAGAGGG + Intergenic
927438633 2:23092564-23092586 TCATCTCTTAAGAAGGTGAAAGG - Intergenic
927659609 2:24981777-24981799 TCCTCTCCTTTGAATCTGGGTGG + Intergenic
927718908 2:25370656-25370678 TCATCTCTTTAGGATTGGGAGGG - Intergenic
929249460 2:39736980-39737002 TGCTCTCTTTACAATCTGTAAGG + Exonic
929880367 2:45831452-45831474 TCCTCTGGGTACAATGTGGAGGG + Intronic
933408907 2:81899496-81899518 TCCTCTCTCTTGACTTTGGAAGG - Intergenic
933462091 2:82601198-82601220 TTCTCAATTTAGAATGTGTAAGG + Intergenic
935669103 2:105540186-105540208 TCCTCACTTTGGAATGAAGAAGG - Intergenic
936549228 2:113420985-113421007 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
937899933 2:127012100-127012122 TCCACTCTTCAGTTTGTGGAGGG - Intergenic
938766196 2:134461925-134461947 TCCTCACTTTGGAAGGTGGGCGG - Intronic
938774403 2:134528963-134528985 TGCTCACTTTAGAAAGTGGGGGG + Intronic
939797061 2:146658149-146658171 TCCTTTCTTTAGAAGGTAAAGGG - Intergenic
939811577 2:146839462-146839484 TCCTTTCTTTGGAATGGGCAAGG - Intergenic
940359471 2:152782035-152782057 GCCTTTCTTTGGAATGTGCAGGG - Intergenic
941232787 2:162931648-162931670 TCCTCTCTTTGGAATTAGGTAGG + Intergenic
943700207 2:190981023-190981045 TCCTCTCTTTAGAGGAGGGAGGG - Intronic
944462229 2:199961954-199961976 TCCTTTCTTCAGAAAATGGAAGG + Intronic
944640593 2:201720867-201720889 TTCTTTCTTTACAATATGGAAGG - Intronic
945430034 2:209753447-209753469 TCCTCTCTATAAAATGTGGCAGG - Intergenic
947782045 2:232776583-232776605 TCCTCTGTTTATAATGTTGTGGG + Intronic
947886199 2:233573736-233573758 TCCTACCTTGAAAATGTGGATGG + Intergenic
1172921478 20:38486447-38486469 TCCTCTCTTCAGAATTGGGAGGG + Intronic
1174961334 20:55160475-55160497 TCCTTTATTTAGAATGTGTAGGG + Intergenic
1176726621 21:10440836-10440858 TCCTCCCTCTAGAGTGTGGGTGG - Intergenic
1176991311 21:15500068-15500090 TTCTCACTTTAGATTGTGGCTGG - Intergenic
1177928217 21:27246513-27246535 GTCTCTCTGTAAAATGTGGATGG + Intergenic
1177948776 21:27507360-27507382 TCCTTTCTATAGATTTTGGAAGG - Intergenic
1178137645 21:29645984-29646006 TCTTCTCTTTGGAATGTGCAAGG - Intronic
1180819333 22:18814851-18814873 TGCTGTCTTTGGAGTGTGGAAGG - Intergenic
1181205558 22:21249296-21249318 TGCTGTCTTTGGAGTGTGGAAGG - Intergenic
1181762825 22:25069639-25069661 TCCTCTCTGTAAAATGGGGATGG + Intronic
1182747817 22:32619021-32619043 TCCTCTCTATAGAATCTGTGAGG + Intronic
1184524365 22:45013067-45013089 ACCTCTCTTGAGATTGGGGAGGG + Intergenic
1203221365 22_KI270731v1_random:46117-46139 TGCTGTCTTTGGAGTGTGGAAGG + Intergenic
1203269461 22_KI270734v1_random:40704-40726 TGCTGTCTTTGGAGTGTGGAAGG - Intergenic
949134108 3:541656-541678 TCCACTCTTTAATTTGTGGAGGG - Intergenic
950780316 3:15386163-15386185 TCCCCTTTTTAGAATATGTAGGG + Intronic
951245789 3:20340293-20340315 ACCAATCTTTAGAATGTGGTAGG + Intergenic
951368211 3:21811952-21811974 TACTTTCTTTAGAATTTTGAAGG - Intronic
951600803 3:24372701-24372723 TCCTGTCTGTAAAATGGGGATGG - Intronic
953375902 3:42428359-42428381 TCCTGTCTTCAGATTGAGGAAGG + Intergenic
953600516 3:44359290-44359312 ACCTTTCTTTGGAATGTGCAAGG - Intronic
954119828 3:48490842-48490864 TACTCTCTTTAGGATTGGGAGGG - Intronic
955096008 3:55799048-55799070 TCATCTCTATATAATATGGAAGG + Intronic
955836482 3:63061171-63061193 TCCTGTGTTTAGAGTTTGGAGGG + Intergenic
956760554 3:72439778-72439800 TCCTCTCTCTAGAACGTGTAAGG + Intronic
957347783 3:78984146-78984168 TCCTCTCATTAGATTATTGAGGG - Intronic
961070537 3:123919956-123919978 TCTTCTCTTTAAAATGTTCAGGG + Intronic
962849736 3:139299448-139299470 TCCTCTCTCTGGGATGAGGATGG - Intronic
963118548 3:141755433-141755455 GCTTCTCTTAAGAATGTGGTCGG + Intergenic
965491641 3:169344462-169344484 TCCTCTCTGTAGAATATTTAAGG - Intronic
966548255 3:181175538-181175560 TTCACTCTTTTGAATTTGGAAGG + Intergenic
969211389 4:5690305-5690327 TCCTTTCTCCTGAATGTGGAGGG - Intronic
970181407 4:13399944-13399966 TTTTCTACTTAGAATGTGGAAGG - Intronic
970968983 4:21959628-21959650 TCCTCTGTACAGAATGAGGAAGG + Intergenic
972734015 4:41822570-41822592 TTTTCCCTATAGAATGTGGAGGG + Intergenic
975056239 4:69933969-69933991 TCCTTTCTTTAGATTATGGCTGG - Intronic
977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG + Intergenic
977965551 4:103143449-103143471 ACCTTTCTATAGCATGTGGATGG - Intronic
979574108 4:122266080-122266102 ACCTATATTTAGAATGTAGAAGG + Intronic
979830794 4:125298795-125298817 TCCTTTCTTTGGAATGTGCAAGG + Intergenic
980007317 4:127557936-127557958 TCCTCTCTTTAGCCCCTGGAAGG - Intergenic
980052885 4:128055556-128055578 TAATCTCTTTAGGATTTGGAGGG + Intergenic
980079003 4:128323867-128323889 TCCCCTTTTTAGAATGTATAAGG - Intergenic
982143937 4:152361269-152361291 TCCTCTTTTTAAAATGTAGTGGG - Intronic
983166156 4:164479202-164479224 TCCCCTCTTTTGAGTGTGGGTGG - Intergenic
983625712 4:169799953-169799975 TCCTCCCTTTGGCATGTGGCTGG + Intergenic
984676909 4:182559770-182559792 TACTCTCTATAGAATGTAGAAGG - Intronic
986565995 5:9115215-9115237 TCCTGTCAGTAGAATGTGCAGGG - Intronic
988752950 5:34210342-34210364 TACTCTCTTTAGAAGGAGTACGG + Intergenic
988801634 5:34701386-34701408 TAATCTCTTTAGAATTTGGGAGG - Intronic
989016882 5:36946403-36946425 TCCTCCCTTAAACATGTGGATGG + Intronic
991614942 5:68486317-68486339 TCCTCTCTCTGGAATCTGAAGGG + Intergenic
991740726 5:69671149-69671171 TACTCTCTTTAGAAGGAGTACGG + Intergenic
991756893 5:69883301-69883323 TACTCTCTTTAGAAGGAGTACGG - Intergenic
991792300 5:70250890-70250912 TACTCTCTTTAGAAGGAGTACGG + Intergenic
991820186 5:70547255-70547277 TACTCTCTTTAGAAGGAGTACGG + Intergenic
991836296 5:70759183-70759205 TACTCTCTTTAGAAGGAGTACGG - Intergenic
991884748 5:71251215-71251237 TACTCTCTTTAGAAGGAGTACGG + Intergenic
992848966 5:80784691-80784713 TCACCACTTTAAAATGTGGAGGG - Intronic
992936578 5:81713306-81713328 TCCCCTGTTTGGAGTGTGGAGGG - Intronic
992975055 5:82107791-82107813 TCCTCTGTTTACAATGCAGAAGG + Intronic
993338120 5:86687186-86687208 TCCCCTCCTAAGACTGTGGAAGG + Intergenic
993894503 5:93516456-93516478 TACTTTCTTTAGAATGGGAAGGG - Intergenic
995132537 5:108645709-108645731 TCCACTCTATACATTGTGGAAGG + Intergenic
995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG + Intergenic
995928484 5:117406182-117406204 TCCTCTCTGGAGAATGTGCTAGG - Intergenic
996096082 5:119400595-119400617 TCCTTTCTTTGGAATTTGCAGGG + Intergenic
997419575 5:133755387-133755409 TCCTGTCTATAGCAGGTGGAGGG - Intergenic
998399405 5:141840697-141840719 TCCTCTCTATAGAGACTGGAGGG - Intergenic
999101288 5:149028049-149028071 TGCTCCATTGAGAATGTGGATGG + Exonic
999967623 5:156826410-156826432 CCCTCTCTCTAGCCTGTGGATGG - Intergenic
1000645338 5:163754645-163754667 TCCACTCTTCAGTTTGTGGAGGG - Intergenic
1001673502 5:173493375-173493397 TCCTCTCTTTAGAAAGATGCAGG - Intergenic
1003238418 6:4319437-4319459 TCTTCTCTTTCAAATGAGGAAGG - Intergenic
1005551115 6:26917121-26917143 TACTCTCTTTAGAAGGAGTACGG + Intergenic
1007058029 6:38907677-38907699 TCATCTCTTTAAAATGTCCAGGG - Intronic
1008037785 6:46764355-46764377 TCTTCACTTAATAATGTGGAGGG - Intergenic
1009321967 6:62302768-62302790 TCTTCTCTTTTGAATCAGGAAGG + Intergenic
1010152095 6:72744881-72744903 TCCTATAGTTAGAATGGGGAAGG + Intronic
1012011436 6:93791420-93791442 TTCTCCCCTTAAAATGTGGAGGG - Intergenic
1014022368 6:116605792-116605814 TCCTCTCTTTAGACTATATAAGG + Intergenic
1015104729 6:129522435-129522457 TTCTCTCTTTGGCTTGTGGATGG - Intergenic
1015457215 6:133439940-133439962 ACCTTTCTTTTGAATGTGCAGGG + Intronic
1016557905 6:145360319-145360341 TAATCTCTTTAGAATTGGGAGGG + Intergenic
1017863489 6:158421620-158421642 TAGTCTCTTTAGAATTGGGAGGG + Intronic
1018327760 6:162692290-162692312 TCTTTTCTTTAGAATGTGTGTGG - Intronic
1019062976 6:169270220-169270242 TAATCTCTTTAGAATTGGGAGGG - Intergenic
1019157434 6:170048733-170048755 TCCTCTTTTTGGAAGGAGGAGGG - Intergenic
1019969418 7:4528167-4528189 TTCTTTCTTTGGAATGTGCAGGG - Intergenic
1021406601 7:20275228-20275250 TACTCTCTTGAGAATGTGGGAGG - Intergenic
1024110820 7:46144831-46144853 TCTCCTCTTTAGATGGTGGAGGG - Intergenic
1024115700 7:46191124-46191146 TCTTCTCTTGAGAATTTGGTTGG - Intergenic
1024495014 7:50035819-50035841 TCCTCTCTTTAACATTTTGAGGG - Intronic
1028084752 7:86622799-86622821 TTCTATCTTTTGAATGAGGATGG + Intergenic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1030542813 7:110853404-110853426 TACTCTCTATAGAAAGTTGATGG - Intronic
1031521639 7:122773827-122773849 TCATTTCTTTAAAATGTGAAAGG - Intronic
1031969009 7:128050188-128050210 CCCTCTTTTTAGCATGTGGATGG + Intronic
1033162799 7:139012282-139012304 TAATCTCTTTAGAATTGGGAGGG - Intergenic
1033162808 7:139012347-139012369 TAATCTCTTTAGAATTGGGAGGG + Intergenic
1033252948 7:139777012-139777034 TCCCCTCATTAGCGTGTGGAAGG - Intronic
1034589104 7:152124495-152124517 TCCTCTCTCACGAATGTGGGTGG + Intergenic
1034592539 7:152154371-152154393 TCCTCTCCTGAGAGTGTGGTTGG - Exonic
1034603484 7:152287117-152287139 TCCTCCCTCTAGAGTGTGGGTGG + Intronic
1035409393 7:158626842-158626864 TCCACTCTTCAGTTTGTGGAGGG - Intergenic
1036496870 8:9277696-9277718 CCTTCTCTTCAGAATATGGAGGG + Intergenic
1036984736 8:13515945-13515967 TCCTCTTTAGAGAATGTGGAAGG + Intergenic
1037009490 8:13823000-13823022 TTCTCTCTTTAAAATGTTTAAGG + Intergenic
1038327617 8:26584382-26584404 GCTTCTTTTTAGAATGAGGATGG + Intronic
1038875497 8:31543901-31543923 TCCTGTAGTTAGAATGTGCATGG - Intergenic
1039393886 8:37206348-37206370 TCGTCTCCTTAGAAGGTGAAAGG + Intergenic
1039724009 8:40195844-40195866 TGCTGACTTTAAAATGTGGAAGG - Intergenic
1040542502 8:48372754-48372776 TCCCCTCTTCAGAATGCTGAGGG + Intergenic
1042589882 8:70387675-70387697 TCCTCTCTGATGAATCTGGATGG + Intronic
1043108863 8:76152093-76152115 TCCTTCCTTTAGCATGTGTATGG - Intergenic
1043816008 8:84802426-84802448 TCTTCTCTTGAGCATTTGGAAGG + Intronic
1044318429 8:90775760-90775782 TCCTGTCTCTAGTATGTGGTAGG - Intronic
1046900148 8:119515144-119515166 TTCTCTCTATAGAAAGTGAAAGG - Intergenic
1048285132 8:133135642-133135664 TCCTATCTTGCAAATGTGGAAGG + Intergenic
1049077150 8:140407547-140407569 CCCTTTCTTTAAAAGGTGGAGGG - Intronic
1049903712 9:195862-195884 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1053746718 9:41206166-41206188 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1054480566 9:65659191-65659213 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
1054681627 9:68225116-68225138 TTTTCTCTTTTGAATGTGGTAGG - Intergenic
1055732496 9:79292786-79292808 CCCTCTCTTTTGAGTGTGGGTGG + Intergenic
1056508212 9:87277624-87277646 TTCTCTCTTGATTATGTGGAGGG - Intergenic
1057142944 9:92738515-92738537 TTCTCTCTTGAGAGTGGGGAGGG - Intronic
1057298657 9:93863859-93863881 CCCTTTCTATAGAATGGGGAGGG - Intergenic
1059034519 9:110739640-110739662 ACCTTTCTTTGGAATGTGTAGGG + Intronic
1059780816 9:117525100-117525122 TCCTGTCTATAGGATGTTGAAGG - Intergenic
1060009535 9:120031535-120031557 TTCTTTCTTTAGGATGTTGAGGG + Intergenic
1062052486 9:134454799-134454821 ACCTTTCTTTGGAATGTGCAGGG - Intergenic
1202782848 9_KI270718v1_random:16945-16967 TTTTCTCTTTTGAATGTGGTAGG + Intergenic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1186135554 X:6516522-6516544 ATCTTTTTTTAGAATGTGGAGGG + Intergenic
1186666622 X:11723499-11723521 ACCTCTCTTTATAAAGTGAAGGG - Intergenic
1186856163 X:13628208-13628230 ACCTTTCTTTGGAATGTGTATGG + Intronic
1187374653 X:18740938-18740960 TGCTCTCATTAAAATGTGTATGG + Intronic
1187405191 X:18997341-18997363 TCTTCTCATTAGAATATGAATGG - Intronic
1187454601 X:19430139-19430161 TCCACCCTTTTGAATGTGGGCGG + Intronic
1190774838 X:53544414-53544436 TCCTTTTTTCAGAATGTTGATGG - Intronic
1192752494 X:74008579-74008601 TCATCTCAATAGATTGTGGACGG + Intergenic
1193047100 X:77065160-77065182 TGCTCTTTTTGGAAGGTGGAAGG - Intergenic
1193599973 X:83499859-83499881 TCCTCCTTTTAAAATGTGGTAGG + Intergenic
1193660191 X:84248038-84248060 TAATCTCTTTAGAATTGGGAGGG + Intergenic
1194296345 X:92131258-92131280 TCCTCACTTTAGGACTTGGAAGG - Intronic
1195767770 X:108314777-108314799 TCCTATCTGTAAAATGAGGATGG + Intronic
1196087843 X:111705652-111705674 TCCTTTTTTTTGCATGTGGATGG + Intronic
1198672312 X:139094156-139094178 TCCTTTCTTAAAAATGTGGCAGG + Intronic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1200801481 Y:7391130-7391152 TACTCTCTTTAGAATTGGGAGGG - Intergenic
1202060087 Y:20877674-20877696 TCATCTCTTCAGAATTGGGAGGG + Intergenic