ID: 1185650708

View in Genome Browser
Species Human (GRCh38)
Location X:1645967-1645989
Sequence GTGGTAGACATGGCTATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185650700_1185650708 -7 Left 1185650700 X:1645951-1645973 CCAAGTCCCCATCCATGTGGTAG No data
Right 1185650708 X:1645967-1645989 GTGGTAGACATGGCTATGGTGGG No data
1185650698_1185650708 6 Left 1185650698 X:1645938-1645960 CCTGGCTGGTTTTCCAAGTCCCC No data
Right 1185650708 X:1645967-1645989 GTGGTAGACATGGCTATGGTGGG No data
1185650695_1185650708 23 Left 1185650695 X:1645921-1645943 CCCTTTTGATGCTGGAGCCTGGC No data
Right 1185650708 X:1645967-1645989 GTGGTAGACATGGCTATGGTGGG No data
1185650696_1185650708 22 Left 1185650696 X:1645922-1645944 CCTTTTGATGCTGGAGCCTGGCT No data
Right 1185650708 X:1645967-1645989 GTGGTAGACATGGCTATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185650708 Original CRISPR GTGGTAGACATGGCTATGGT GGG Intergenic
No off target data available for this crispr