ID: 1185654820

View in Genome Browser
Species Human (GRCh38)
Location X:1676489-1676511
Sequence TGTATAAAACATCTACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185654818_1185654820 15 Left 1185654818 X:1676451-1676473 CCTATCTACATGTGTGTTTACAT No data
Right 1185654820 X:1676489-1676511 TGTATAAAACATCTACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185654820 Original CRISPR TGTATAAAACATCTACCTCC AGG Intergenic
No off target data available for this crispr