ID: 1185654822

View in Genome Browser
Species Human (GRCh38)
Location X:1676494-1676516
Sequence AAAACATCTACCTCCAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185654818_1185654822 20 Left 1185654818 X:1676451-1676473 CCTATCTACATGTGTGTTTACAT No data
Right 1185654822 X:1676494-1676516 AAAACATCTACCTCCAGGCTGGG No data
1185654819_1185654822 -9 Left 1185654819 X:1676480-1676502 CCATAAGTATGTATAAAACATCT No data
Right 1185654822 X:1676494-1676516 AAAACATCTACCTCCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185654822 Original CRISPR AAAACATCTACCTCCAGGCT GGG Intergenic
No off target data available for this crispr