ID: 1185654822 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:1676494-1676516 |
| Sequence | AAAACATCTACCTCCAGGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185654818_1185654822 | 20 | Left | 1185654818 | X:1676451-1676473 | CCTATCTACATGTGTGTTTACAT | No data | ||
| Right | 1185654822 | X:1676494-1676516 | AAAACATCTACCTCCAGGCTGGG | No data | ||||
| 1185654819_1185654822 | -9 | Left | 1185654819 | X:1676480-1676502 | CCATAAGTATGTATAAAACATCT | No data | ||
| Right | 1185654822 | X:1676494-1676516 | AAAACATCTACCTCCAGGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185654822 | Original CRISPR | AAAACATCTACCTCCAGGCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||