ID: 1185654823 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:1676502-1676524 |
| Sequence | TACCTCCAGGCTGGGCGCAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185654819_1185654823 | -1 | Left | 1185654819 | X:1676480-1676502 | CCATAAGTATGTATAAAACATCT | No data | ||
| Right | 1185654823 | X:1676502-1676524 | TACCTCCAGGCTGGGCGCAGTGG | No data | ||||
| 1185654818_1185654823 | 28 | Left | 1185654818 | X:1676451-1676473 | CCTATCTACATGTGTGTTTACAT | No data | ||
| Right | 1185654823 | X:1676502-1676524 | TACCTCCAGGCTGGGCGCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185654823 | Original CRISPR | TACCTCCAGGCTGGGCGCAG TGG | Intergenic | ||
| No off target data available for this crispr | |||||