ID: 1185656587

View in Genome Browser
Species Human (GRCh38)
Location X:1690446-1690468
Sequence CTGTGGGAGGGGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185656587_1185656600 17 Left 1185656587 X:1690446-1690468 CCCTCCTCATTCCCCTCCCACAG No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656587_1185656601 25 Left 1185656587 X:1690446-1690468 CCCTCCTCATTCCCCTCCCACAG No data
Right 1185656601 X:1690494-1690516 GAGGAAAGAAATAGGAAAAGCGG No data
1185656587_1185656599 6 Left 1185656587 X:1690446-1690468 CCCTCCTCATTCCCCTCCCACAG No data
Right 1185656599 X:1690475-1690497 GCTGTAAGAGTTAAAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185656587 Original CRISPR CTGTGGGAGGGGAATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr