ID: 1185656600

View in Genome Browser
Species Human (GRCh38)
Location X:1690486-1690508
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185656597_1185656600 -7 Left 1185656597 X:1690470-1690492 CCCTGGCTGTAAGAGTTAAAGAA No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656589_1185656600 13 Left 1185656589 X:1690450-1690472 CCTCATTCCCCTCCCACAGCCCC No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656587_1185656600 17 Left 1185656587 X:1690446-1690468 CCCTCCTCATTCCCCTCCCACAG No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656593_1185656600 4 Left 1185656593 X:1690459-1690481 CCTCCCACAGCCCCTGGCTGTAA No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656591_1185656600 6 Left 1185656591 X:1690457-1690479 CCCCTCCCACAGCCCCTGGCTGT No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656595_1185656600 0 Left 1185656595 X:1690463-1690485 CCACAGCCCCTGGCTGTAAGAGT No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656596_1185656600 -6 Left 1185656596 X:1690469-1690491 CCCCTGGCTGTAAGAGTTAAAGA No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656592_1185656600 5 Left 1185656592 X:1690458-1690480 CCCTCCCACAGCCCCTGGCTGTA No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656594_1185656600 1 Left 1185656594 X:1690462-1690484 CCCACAGCCCCTGGCTGTAAGAG No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656588_1185656600 16 Left 1185656588 X:1690447-1690469 CCTCCTCATTCCCCTCCCACAGC No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data
1185656598_1185656600 -8 Left 1185656598 X:1690471-1690493 CCTGGCTGTAAGAGTTAAAGAAA No data
Right 1185656600 X:1690486-1690508 TAAAGAAAGAGGAAAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185656600 Original CRISPR TAAAGAAAGAGGAAAGAAAT AGG Intergenic
No off target data available for this crispr