ID: 1185664333

View in Genome Browser
Species Human (GRCh38)
Location X:1752778-1752800
Sequence GGCCATCTTAAAAGAGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185664327_1185664333 23 Left 1185664327 X:1752732-1752754 CCTTCCCAGGGGCATTCATTACC No data
Right 1185664333 X:1752778-1752800 GGCCATCTTAAAAGAGCTGATGG No data
1185664329_1185664333 18 Left 1185664329 X:1752737-1752759 CCAGGGGCATTCATTACCTTAAA No data
Right 1185664333 X:1752778-1752800 GGCCATCTTAAAAGAGCTGATGG No data
1185664330_1185664333 2 Left 1185664330 X:1752753-1752775 CCTTAAAATTCTAAAAGAAATTC No data
Right 1185664333 X:1752778-1752800 GGCCATCTTAAAAGAGCTGATGG No data
1185664328_1185664333 19 Left 1185664328 X:1752736-1752758 CCCAGGGGCATTCATTACCTTAA No data
Right 1185664333 X:1752778-1752800 GGCCATCTTAAAAGAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185664333 Original CRISPR GGCCATCTTAAAAGAGCTGA TGG Intergenic
No off target data available for this crispr