ID: 1185668197

View in Genome Browser
Species Human (GRCh38)
Location X:1785051-1785073
Sequence ATCATGCTTAACCCTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185668197_1185668199 -2 Left 1185668197 X:1785051-1785073 CCAGGTGTAGGGTTAAGCATGAT No data
Right 1185668199 X:1785072-1785094 ATTTTCCAAATGGAAGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185668197 Original CRISPR ATCATGCTTAACCCTACACC TGG (reversed) Intergenic
No off target data available for this crispr