ID: 1185669294

View in Genome Browser
Species Human (GRCh38)
Location X:1792919-1792941
Sequence GTTCTCAGAGGACCCCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185669294_1185669298 26 Left 1185669294 X:1792919-1792941 CCTGGATGGGGTCCTCTGAGAAC No data
Right 1185669298 X:1792968-1792990 TCTCCAGCCTAGCCTGAATCAGG No data
1185669294_1185669300 30 Left 1185669294 X:1792919-1792941 CCTGGATGGGGTCCTCTGAGAAC No data
Right 1185669300 X:1792972-1792994 CAGCCTAGCCTGAATCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185669294 Original CRISPR GTTCTCAGAGGACCCCATCC AGG (reversed) Intergenic
No off target data available for this crispr