ID: 1185672058

View in Genome Browser
Species Human (GRCh38)
Location X:1820760-1820782
Sequence TCACTACTGCTCTCATGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185672058_1185672062 17 Left 1185672058 X:1820760-1820782 CCACCGCATGAGAGCAGTAGTGA No data
Right 1185672062 X:1820800-1820822 ACAGCAGCAGCCGGGTGTGTTGG No data
1185672058_1185672061 9 Left 1185672058 X:1820760-1820782 CCACCGCATGAGAGCAGTAGTGA No data
Right 1185672061 X:1820792-1820814 TAAAAGTAACAGCAGCAGCCGGG No data
1185672058_1185672060 8 Left 1185672058 X:1820760-1820782 CCACCGCATGAGAGCAGTAGTGA No data
Right 1185672060 X:1820791-1820813 ATAAAAGTAACAGCAGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185672058 Original CRISPR TCACTACTGCTCTCATGCGG TGG (reversed) Intergenic
No off target data available for this crispr