ID: 1185684584

View in Genome Browser
Species Human (GRCh38)
Location X:1917871-1917893
Sequence CCTTTTTAGCACACGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185684584_1185684601 28 Left 1185684584 X:1917871-1917893 CCTTCCACCGTGTGCTAAAAAGG No data
Right 1185684601 X:1917922-1917944 GGTACCTCCTTGCAGCTGCCAGG No data
1185684584_1185684594 0 Left 1185684584 X:1917871-1917893 CCTTCCACCGTGTGCTAAAAAGG No data
Right 1185684594 X:1917894-1917916 GGAGGGGGAGTTTCCGTGCCTGG No data
1185684584_1185684595 7 Left 1185684584 X:1917871-1917893 CCTTCCACCGTGTGCTAAAAAGG No data
Right 1185684595 X:1917901-1917923 GAGTTTCCGTGCCTGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185684584 Original CRISPR CCTTTTTAGCACACGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr