ID: 1185689167

View in Genome Browser
Species Human (GRCh38)
Location X:2139149-2139171
Sequence CAATCCTCACTGATGGCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185689167_1185689170 30 Left 1185689167 X:2139149-2139171 CCTAGTGCCATCAGTGAGGATTG No data
Right 1185689170 X:2139202-2139224 AATCCAAGCCTCAGTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185689167 Original CRISPR CAATCCTCACTGATGGCACT AGG (reversed) Intergenic
No off target data available for this crispr