ID: 1185691581

View in Genome Browser
Species Human (GRCh38)
Location X:2159403-2159425
Sequence TAGAGTAAGGTCAACAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185691581_1185691585 24 Left 1185691581 X:2159403-2159425 CCTGGTCTGTTGACCTTACTCTA No data
Right 1185691585 X:2159450-2159472 TTTAAAACCATTCCCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185691581 Original CRISPR TAGAGTAAGGTCAACAGACC AGG (reversed) Intergenic
No off target data available for this crispr