ID: 1185697877

View in Genome Browser
Species Human (GRCh38)
Location X:2209005-2209027
Sequence CTGTGTGCTCACAAGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185697871_1185697877 16 Left 1185697871 X:2208966-2208988 CCAAGTCTTTGCTATTGTGAACA 0: 1684
1: 20849
2: 12578
3: 9648
4: 8382
Right 1185697877 X:2209005-2209027 CTGTGTGCTCACAAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185697877 Original CRISPR CTGTGTGCTCACAAGGCAGT GGG Intergenic
No off target data available for this crispr