ID: 1185699246

View in Genome Browser
Species Human (GRCh38)
Location X:2217927-2217949
Sequence GTGTTCAGACAGCCCATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185699246_1185699247 -8 Left 1185699246 X:2217927-2217949 CCTGCAATGGGCTGTCTGAACAC No data
Right 1185699247 X:2217942-2217964 CTGAACACACAGCCATCTCATGG No data
1185699246_1185699248 -7 Left 1185699246 X:2217927-2217949 CCTGCAATGGGCTGTCTGAACAC No data
Right 1185699248 X:2217943-2217965 TGAACACACAGCCATCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185699246 Original CRISPR GTGTTCAGACAGCCCATTGC AGG (reversed) Intergenic
No off target data available for this crispr