ID: 1185699688

View in Genome Browser
Species Human (GRCh38)
Location X:2221282-2221304
Sequence CAGGAGTCTCAGGACTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185699688 Original CRISPR CAGGAGTCTCAGGACTCACA TGG Intronic
900539651 1:3196469-3196491 CAGCATTCTCAGGCCCCACAAGG - Intronic
901678047 1:10898309-10898331 CAGGAGTCCCAGGGGTCAGAGGG + Intergenic
901971463 1:12912227-12912249 AAGGAATCTCAGAACTTACATGG - Intronic
902013705 1:13289513-13289535 AAGGAATCTCAGAACTTACATGG + Intergenic
903016163 1:20363502-20363524 CAGGAGGCTCAAGACACAGAAGG + Intergenic
903104357 1:21062502-21062524 CAGTAGTCTCAGGATTGATATGG + Intronic
904216147 1:28921456-28921478 CAGGACTCTCAGGAGTGCCAAGG + Intronic
904412753 1:30334962-30334984 CCAGAGACTCAGGACTCAGAGGG + Intergenic
914217820 1:145649256-145649278 CAGGAATCTCAGGAATCTCATGG - Intronic
914470375 1:147971932-147971954 CAGGAATCTCAGGAATCTCATGG - Intronic
917359564 1:174160288-174160310 CAGGACACTGAGCACTCACAAGG - Intronic
918497631 1:185157406-185157428 CTGGGGACTCAGGAGTCACACGG + Intronic
918962459 1:191298000-191298022 TAGCAGTCTCAGGACTCACAAGG + Intergenic
920557762 1:206916464-206916486 CAGCAGCCTCAGGCCTCCCAGGG + Intronic
920976404 1:210790025-210790047 CAGGAGGCTGAGGCCTCAGAAGG - Intronic
1064733226 10:18354668-18354690 GAGGAGTCTCAGGACCCAGCAGG + Intronic
1067289952 10:44933326-44933348 CTGGAGGCTCAGGGCTCACTGGG - Intronic
1070975565 10:80603408-80603430 CAGGAACCTCAGGATTCACCTGG - Intronic
1076055941 10:127372949-127372971 CCGGAGTCCCAGTACTCAGATGG + Intronic
1076382966 10:130037642-130037664 CAGGAGGCTGTGCACTCACAGGG + Intergenic
1076795568 10:132796544-132796566 CAGCACTCTCAGGGGTCACATGG + Intergenic
1077191940 11:1259269-1259291 CAGGTGACTCAGGTCTCACCTGG - Intronic
1077650798 11:3970292-3970314 CTGCAATCTCAGGCCTCACATGG + Intronic
1079686488 11:23365286-23365308 CTGAAGTCCCAGGATTCACATGG + Intergenic
1080402271 11:31947252-31947274 CAGTAGTCACAGGCCTCACCCGG - Intronic
1081673758 11:44956469-44956491 CAGGAGTGGCAGGCCTTACAAGG - Intergenic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1082997182 11:59263589-59263611 CAGGAGACACAGGACACACGAGG + Intergenic
1083277060 11:61602883-61602905 CAGGAGCCCCAGGCCTCAGATGG + Intergenic
1083413134 11:62507198-62507220 CAGCAGAGTCAGGATTCACACGG - Intronic
1086048325 11:82559504-82559526 AATGAGGCTCACGACTCACAGGG + Intergenic
1087353394 11:97061734-97061756 CAGGAGTCTCAGGGATCCCCAGG + Intergenic
1087550062 11:99638118-99638140 CAAGATTCTGAGGCCTCACAAGG - Intronic
1087683764 11:101241309-101241331 AGGGAGGCTCAGGACGCACAGGG + Intergenic
1088580460 11:111310651-111310673 CAGGTGCCACAGGACTGACATGG - Intergenic
1088595459 11:111437379-111437401 CAGGAGTCCCTGGACTCATCTGG - Intronic
1089736019 11:120550686-120550708 CCGGGGCCTCAGGACTCACCTGG - Intronic
1094599725 12:31898094-31898116 AAGGAGTCCCAAGAGTCACATGG + Intergenic
1095499056 12:42816508-42816530 CAGGAGTCTAACAACTCAGAAGG + Intergenic
1098641150 12:72839550-72839572 CAGGAGATTGAGAACTCACAGGG - Intergenic
1100121741 12:91376409-91376431 CAGAAGTATCAGGAGTCAGACGG - Intergenic
1101281082 12:103256431-103256453 CAAGAGCCCCAGGACCCACATGG + Intronic
1101591189 12:106126877-106126899 CAGGAGCCTCTGGCCTCACTGGG + Intronic
1104163338 12:126202241-126202263 AAGGAGCCTCAGATCTCACAGGG + Intergenic
1104420044 12:128627675-128627697 CAGGGGACCCAGGGCTCACAGGG - Intronic
1104923056 12:132301083-132301105 CAGGAGTCTCATCAGTTACATGG - Intronic
1106125653 13:26898194-26898216 TGGGAGACTCAGGACCCACATGG + Intergenic
1106402089 13:29441007-29441029 AAGAAGTCACAGAACTCACAGGG - Intronic
1106722959 13:32454993-32455015 CAGTAGTCTCAGGGCTTACAAGG - Intronic
1112108670 13:96270230-96270252 CAAGAGACTGAGGACTCAGAAGG + Intronic
1112337200 13:98525369-98525391 CAGGAGAATCAGGACGCCCAAGG + Intronic
1113982995 13:114291981-114292003 CAGCAGCCTGAGGACTCCCAGGG - Intronic
1114040603 14:18674741-18674763 CTGGATTCTCAGTCCTCACATGG + Intergenic
1114045641 14:18873252-18873274 CTGGATTCTCAGTCCTCACATGG + Intergenic
1114118570 14:19646216-19646238 CTGGATTCTCAGTCCTCACATGG - Intergenic
1114537115 14:23430010-23430032 TGGGAGTCTCAGAACCCACAGGG - Intronic
1116441665 14:44961845-44961867 CCTGAGTCTCAGTAATCACACGG + Exonic
1118005353 14:61560365-61560387 CAGGAGCTTCAGAACTGACAGGG - Intronic
1118905496 14:70020507-70020529 CAGGACCCTCGGGCCTCACAGGG + Intronic
1121419408 14:93802100-93802122 CAGAAGACTCAGGACACACAAGG + Intergenic
1122468494 14:101950175-101950197 CAGGATTCTAAGGACTGACATGG + Intergenic
1124322322 15:28724296-28724318 CAGGAGTCACAGGACACAACTGG + Intronic
1124523413 15:30426101-30426123 CAGGAGTCACAGGACACAACTGG + Intergenic
1124535253 15:30540113-30540135 CAGGAGTCACAGGACACAACTGG - Intergenic
1124763401 15:32467483-32467505 CAGGAGTCACAGGACACAACTGG + Intergenic
1124775225 15:32581564-32581586 CAGGAGTCACAGGACACAACTGG - Intergenic
1126349856 15:47733598-47733620 CCGGACTCTCTGGACTCACAAGG - Intronic
1126805784 15:52347984-52348006 CTGGTATCTCAGGACTTACATGG + Intronic
1130666132 15:85871620-85871642 CAGGACTCTCAGAGCTCAGAGGG - Intergenic
1130769325 15:86908545-86908567 CAGAATTCTCTGGAGTCACATGG + Intronic
1132625885 16:891268-891290 CAGGATCCCCAGGACTCACCTGG - Intronic
1137288662 16:47037270-47037292 CAGGAGTCTCAGGACCAGCCTGG - Intergenic
1139294910 16:65892278-65892300 CTGGAGTCTCAGGACTGCCAGGG + Intergenic
1139591138 16:67933904-67933926 TAAGGGTCACAGGACTCACATGG - Intronic
1141719303 16:85746796-85746818 CAGCAGGCTCACGACACACATGG + Intronic
1141742609 16:85904051-85904073 CAGGACTCTGATGACCCACAAGG - Intronic
1142877920 17:2863452-2863474 CAGCTGTCTCAGGACACACATGG - Intronic
1142978636 17:3659211-3659233 CAGCAGTCAGAGGACCCACAGGG + Intronic
1143850010 17:9803866-9803888 CAGCAGTATCTGGACTCACAGGG - Intronic
1144692992 17:17281022-17281044 GAAGAGTCTCAGGACTAAAAGGG + Intronic
1145294633 17:21578517-21578539 CAAGTGTCTCAGTACACACAGGG - Intergenic
1147869708 17:43578768-43578790 CAGGAGGGTCAGGAATCGCATGG + Intronic
1147892270 17:43725827-43725849 CTGGAGGCTCAGGACTCCAAAGG - Intergenic
1148063308 17:44851259-44851281 CAGGAGTCCACGCACTCACATGG + Exonic
1149653840 17:58298997-58299019 CAGGAGCATCAGGACTCTCTGGG - Intergenic
1150755029 17:67904236-67904258 CAGGAGTTCCAAGACTCACCTGG - Intronic
1150960728 17:69909599-69909621 CAGGAGCCTCAGCAAGCACATGG + Intergenic
1151944367 17:77311439-77311461 CAGGTGTCTCTGCCCTCACAGGG + Intronic
1152196055 17:78919122-78919144 CTGGAGTTTCAGGACTCTCCAGG - Intronic
1153140515 18:1967179-1967201 CAGCAGTCTCAGAACCCACATGG - Intergenic
1156447800 18:37249950-37249972 CCAGAGTCACAGGACTCACTGGG + Intronic
1158750012 18:60247903-60247925 CAGGACCCTCAGTAGTCACAGGG - Intergenic
1160214523 18:76916693-76916715 CAAGAGTGTCAGAACACACACGG - Intronic
1160618105 18:80149063-80149085 CAGAAGTCTCAGCTCTCACCTGG - Intronic
1161511590 19:4675188-4675210 CAGGAGCCCCAGGACTTAGAAGG + Intergenic
1164984350 19:32637709-32637731 CAGGAATCTCTGCACTCTCAGGG + Intronic
1166093910 19:40528075-40528097 AAGGACTCTAAGGACTCTCATGG + Intronic
1167344606 19:48937342-48937364 CAAGAGTGTCAGGGCTCACGGGG - Intronic
1168058145 19:53875037-53875059 AAGAAGTCTCAGGGCTCCCAAGG - Exonic
1168309288 19:55452483-55452505 CAGGAGTTCCGGGACCCACATGG - Intergenic
927110402 2:19860385-19860407 CAGAAGTCCCAGGACTGGCAAGG - Intergenic
927869945 2:26616997-26617019 CAGGAGTCTTAGAGCACACATGG + Intronic
928443323 2:31311698-31311720 CAGGAGACTCAGAGCCCACAGGG + Intergenic
928540854 2:32282220-32282242 CAGGAGTCTGAGGCCACCCAGGG + Intronic
928984921 2:37171463-37171485 GCGAAGTCTCAGGACACACACGG - Exonic
928995320 2:37283440-37283462 CAGGATTTTCTTGACTCACAAGG - Intronic
929237681 2:39624016-39624038 CAAGACTCTCAGGAGTCTCAGGG + Intergenic
931644378 2:64408328-64408350 TAGCAGTCTCAGGACCCACTGGG - Intergenic
933726314 2:85429609-85429631 GAGGAGTCCCAGTACTCACCGGG - Intronic
934620712 2:95802977-95802999 CAGGAGTCTCAGGTGCCACTGGG + Intergenic
934812727 2:97296740-97296762 CAGGAGTCTCAGGTGCCACTGGG - Intergenic
934824968 2:97411732-97411754 CAGGAGTCTCAGGTGCCACTGGG + Intergenic
935281808 2:101524610-101524632 TTGGATACTCAGGACTCACAAGG + Intergenic
938269582 2:129957805-129957827 CTGGATTCTCAGTCCTCACATGG - Intergenic
938381550 2:130839015-130839037 CAGGTGTCTCAGGACCTACAGGG - Intronic
940124920 2:150311993-150312015 CAGGAGGCACAGGAGGCACAGGG - Intergenic
942668387 2:178347255-178347277 CAACACTCTGAGGACTCACATGG - Intronic
943551762 2:189349251-189349273 GAGGAGTCTCAGGGCAAACATGG + Intergenic
945525038 2:210877943-210877965 CAGGGGTCACATGACTCACTGGG + Intergenic
945944308 2:215980242-215980264 CTGAACTGTCAGGACTCACAAGG + Intronic
946095471 2:217270684-217270706 CAGGTTTCCCAGGAGTCACAAGG + Intergenic
947617891 2:231569984-231570006 AAGGATTCACAGGACTCATAAGG + Intergenic
947935217 2:233998432-233998454 CAGGACTCTCAGTACTAAGATGG - Intronic
948626239 2:239270111-239270133 CAGGAGCCTGATGACTCCCACGG + Intronic
1168924167 20:1566004-1566026 CAGGATACTCAGGAGTCTCAGGG - Intronic
1168927987 20:1598673-1598695 CAGCATCCTCAGGACTCTCAGGG - Intronic
1175870713 20:62208257-62208279 CAGGATCCTCTGGGCTCACAGGG + Intergenic
1177021915 21:15872168-15872190 CACTGTTCTCAGGACTCACAAGG - Intronic
1177349220 21:19913191-19913213 CAGGAGTCTCAGACCACACTGGG + Intergenic
1177650286 21:23951474-23951496 TGTGAGTCACAGGACTCACATGG + Intergenic
1179144835 21:38758879-38758901 CAGGAGTCTCACCCCTCAAAAGG - Intergenic
1180096211 21:45556223-45556245 TAGGAGTCTCAGGTCTCCCCGGG - Intergenic
1180464172 22:15595869-15595891 CTGGATTCTCAGTCCTCACATGG + Intergenic
1180626393 22:17196574-17196596 CAGGAGACTCAGTAATGACAGGG - Intronic
1181572238 22:23773857-23773879 CAGGAGTCTCAGGACTGGCCTGG + Intronic
1181844923 22:25699361-25699383 CAGGAGTGTCAGGATGCAGAGGG - Intronic
1182779518 22:32856490-32856512 GAGGAGTCTCAGTACCCAGAAGG - Intronic
950487379 3:13281638-13281660 CAGGAGTCCCAGTACTGTCATGG - Intergenic
951676873 3:25250822-25250844 TGTTAGTCTCAGGACTCACAAGG + Intronic
951691338 3:25399612-25399634 TAGGAAGTTCAGGACTCACACGG - Intronic
951868111 3:27329923-27329945 CAGGAGTTCCAGGACACCCACGG + Intronic
952289142 3:31998369-31998391 CAACAGACTCAGCACTCACATGG - Intronic
952956304 3:38559993-38560015 AAGGAGGCTCAGGACTCTCCAGG - Intronic
953593236 3:44281012-44281034 CATTAGTCTCAGGACCCACAAGG + Intronic
953886253 3:46715854-46715876 CTGGAGTCTCATGCCTCAGAAGG + Intronic
954240352 3:49288768-49288790 CAGCAGTCACAGGCCTAACAAGG + Intronic
954320576 3:49829747-49829769 CAGGAGTCCCAGCTCTCACTGGG - Exonic
955098594 3:55824365-55824387 CAGGAGTCTCTGTTCTGACATGG - Intronic
956790344 3:72675330-72675352 CAGGAGGCCCAGGAATCACTCGG - Intergenic
962025843 3:131546750-131546772 CTGGGGTACCAGGACTCACATGG - Intronic
962262336 3:133920163-133920185 CAGGAGTCTCAGCAGTGAAATGG + Intergenic
962264533 3:133935585-133935607 CAGGCATTTCAGGGCTCACAGGG - Intronic
964985504 3:162732899-162732921 CAGCAGTCACAGGCCTCACCCGG + Intergenic
965928426 3:174012029-174012051 CAGTACTCTCAGAACTCCCAAGG + Intronic
968134859 3:196213915-196213937 CAGGAGTGACAGAACGCACAGGG + Intronic
968196786 3:196712992-196713014 GGGGATTCTCAGGCCTCACAGGG - Intronic
968983073 4:3861159-3861181 CAGGATTCACAGGACTCCCCTGG - Intergenic
975683210 4:76896732-76896754 CAGGATTCCCAGGACTCATCCGG + Exonic
978532801 4:109731107-109731129 CAGGAGTTCCAGGCCTCCCAAGG - Intergenic
981279148 4:142936900-142936922 CAGGTGCCTCAGTCCTCACATGG + Intergenic
981327976 4:143473920-143473942 CAGGAGTCTCATGGTTTACAAGG - Exonic
981924825 4:150127696-150127718 CAGGAGTCTGTAGACACACACGG - Intronic
983141455 4:164154842-164154864 CAGAAGACTCAGGTCACACACGG + Intronic
985748482 5:1661198-1661220 CAGGTGTGTAAGGACTCGCATGG - Intergenic
987335704 5:16896110-16896132 GAGTAATCTCAGGACTCAGAAGG + Intronic
987644300 5:20648783-20648805 CAGGGGTTCCAGGGCTCACAGGG - Intergenic
988470528 5:31532892-31532914 CAGTAATCGTAGGACTCACAGGG + Intronic
990329927 5:54715380-54715402 CCAGGGTCTCAGGTCTCACAAGG + Intergenic
992014804 5:72565054-72565076 AGAGAGTCTCAGGACTCAGAAGG + Intergenic
997658828 5:135574932-135574954 CCAGACTCTCAGGACTCCCAGGG - Intronic
997840382 5:137234225-137234247 CAGGATTCTCAGGACCAGCAGGG + Intronic
998248133 5:140528619-140528641 CAGGATTCACAGGTCTCACTGGG - Exonic
998569379 5:143243813-143243835 CAGAAATCTCAGGAGTCCCAAGG - Intergenic
998996900 5:147875868-147875890 CAGGGGTCTCAGGAATCTCCTGG + Intronic
1001055610 5:168447364-168447386 CAGAATTCTTACGACTCACAAGG - Intronic
1002457644 5:179354743-179354765 AAGGAGTCTCAGGGCTCAGACGG - Intergenic
1002534501 5:179868847-179868869 GAGGAGGCTCAGGAGTCTCAGGG + Intronic
1002953337 6:1837863-1837885 AAGGAGACCCAGGCCTCACAGGG + Intronic
1006155225 6:32009993-32010015 CAGGAGGCTCTGGCCCCACATGG + Intergenic
1006161531 6:32042727-32042749 CAGGAGGCTCTGGCCCCACATGG + Exonic
1006847330 6:37071689-37071711 CAGGAGGCTGAGCACTCAGAAGG + Intergenic
1012617531 6:101294891-101294913 CAAGAGTCCAATGACTCACAGGG - Intergenic
1012711870 6:102617209-102617231 CAGGAGCCCCATGACTCAGATGG - Intergenic
1015738340 6:136425528-136425550 CAGCAGTCTCAGGCCTGATATGG - Intronic
1016076358 6:139801105-139801127 AAGGAGTTTCAGGGCTTACATGG + Intergenic
1018107994 6:160507232-160507254 GAGGAGCTTCAGGACTCTCACGG - Intergenic
1018123532 6:160659825-160659847 GAGGAGCTTCAGGACTCTCACGG - Intronic
1018970544 6:168525838-168525860 CGGGGGTCTCAGGACGCACGCGG - Intronic
1021446904 7:20743745-20743767 CAGGAGAATGAGGACTAACATGG - Intronic
1023987502 7:45105291-45105313 CTGGAGCCTCAGGCATCACATGG - Intronic
1024015744 7:45312483-45312505 TATCAGTCTCAGGACACACAAGG + Intergenic
1024306165 7:47931247-47931269 CAGCAGTCTCAGGACACAGCAGG + Exonic
1027275262 7:76549614-76549636 CAGGCCTCTGAGGACACACACGG - Intergenic
1028383470 7:90225381-90225403 CAGATGTCTCAGGTCCCACAGGG - Exonic
1030139524 7:106290689-106290711 CAGGAGACTGAGCACTGACAGGG + Intergenic
1032089179 7:128902758-128902780 GAGCAGCCTCAGGACTCACCAGG + Exonic
1033359637 7:140629468-140629490 CAGGAGCACCAGGACTCACGTGG + Intronic
1033552121 7:142456952-142456974 TAGGTGTCTCAGGAGTCACATGG - Intergenic
1033554390 7:142475892-142475914 CAGCTATCTCAGGAGTCACATGG - Intergenic
1033559019 7:142513449-142513471 CAGTTGTCTCAGCAGTCACATGG - Intergenic
1034270202 7:149799979-149800001 CAGGGGTCGCTGGAGTCACAGGG - Intergenic
1035724743 8:1817589-1817611 CAGGGGGCTCGGGACTTACAGGG - Intergenic
1037085911 8:14850319-14850341 AAGGAGTCTCAGGACTTTAAAGG + Intronic
1037596660 8:20359964-20359986 CAAGAATGTCATGACTCACAGGG - Intergenic
1042709423 8:71699838-71699860 CAGCAGCCTCAGGATTCACTCGG - Intergenic
1043673283 8:82915648-82915670 CAGGAGTCTGAGGAATCAATAGG + Intergenic
1046935970 8:119886254-119886276 CAGGAATGTCAGGCCTCATATGG + Intronic
1047718848 8:127620113-127620135 GAGGAGTCTCAGGTGGCACAGGG + Intergenic
1048970665 8:139643436-139643458 CAGGGGTCCCAGGACTCACTGGG + Intronic
1049537758 8:143189886-143189908 CAGGCATCTCAGGCCCCACAGGG + Intergenic
1050876876 9:10650748-10650770 CACAAGTCTCAGGGCCCACAAGG - Intergenic
1051029563 9:12658245-12658267 CAGGAGAGCAAGGACTCACAGGG - Intergenic
1052400771 9:27997491-27997513 CAGGAGTCTGAGGCCCAACAAGG - Intronic
1055423372 9:76167419-76167441 CAGCATTCTCAGGTCTCCCATGG - Intronic
1056308750 9:85319126-85319148 CAGGAGGCGCTGGACTCCCATGG - Intergenic
1057860355 9:98636040-98636062 CAGGAGTCGCAGATCTCACCTGG + Intronic
1059572872 9:115459255-115459277 CAGGAGAATCAGGAAGCACACGG - Intergenic
1059573539 9:115466404-115466426 CAGGACTTTTAGGACTCACATGG + Intergenic
1062043273 9:134413859-134413881 CAGGAGTCTCAGGTCTTCCTGGG + Intronic
1185699688 X:2221282-2221304 CAGGAGTCTCAGGACTCACATGG + Intronic
1189065625 X:37805218-37805240 AAGCACTCTCAGGCCTCACATGG - Intronic
1195256132 X:103092953-103092975 CTGGAGTCTCAGGTCTCACAGGG - Intronic
1196187727 X:112762455-112762477 CTAGAGTCACAGGACTCACTGGG + Intergenic
1197643589 X:128993300-128993322 CATAAGTCTCAGGACCCATATGG + Intergenic
1198936819 X:141907681-141907703 GAGGACTCTGAGGACTCTCAGGG - Exonic
1198936835 X:141907786-141907808 GAGGACTCTGAGGACTCTCATGG - Exonic
1199634998 X:149805985-149806007 GAGGAGTCTCAGGACCCTGAGGG + Intergenic