ID: 1185699731

View in Genome Browser
Species Human (GRCh38)
Location X:2221820-2221842
Sequence ACACCCTGGTTTTCTGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185699728_1185699731 9 Left 1185699728 X:2221788-2221810 CCTAGTGGAAGGCGATAATCTTG 0: 1
1: 0
2: 0
3: 0
4: 74
Right 1185699731 X:2221820-2221842 ACACCCTGGTTTTCTGCAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 153
1185699727_1185699731 10 Left 1185699727 X:2221787-2221809 CCCTAGTGGAAGGCGATAATCTT 0: 1
1: 0
2: 0
3: 0
4: 59
Right 1185699731 X:2221820-2221842 ACACCCTGGTTTTCTGCAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185699731 Original CRISPR ACACCCTGGTTTTCTGCAGT GGG Intronic
900689101 1:3968970-3968992 ACTCCCTGCTTTTCTGCACCAGG - Intergenic
901594571 1:10374614-10374636 CCAGCCTGGGTTTCTCCAGTTGG + Intronic
901803493 1:11723190-11723212 ACTGCCTGGTTTTGCGCAGTTGG - Exonic
902846313 1:19113299-19113321 CCACCCTGGTTGATTGCAGTTGG + Intronic
903011975 1:20337758-20337780 GCAGCCTGGCTTTCCGCAGTGGG - Exonic
904372809 1:30060951-30060973 ACACCCTGGGTAGCTGCAGCTGG - Intergenic
912561825 1:110556510-110556532 ACATCCCTGTTTTCTGCAGATGG + Intergenic
914445409 1:147746354-147746376 AAACCCTGTTTTTCTTCTGTGGG + Intergenic
914863413 1:151405501-151405523 CCACCCTGGTTTTCTACAGAGGG - Exonic
915427253 1:155837002-155837024 ACCCCCAGGTTTTCAGCATTTGG + Intronic
916463217 1:165047752-165047774 ACTCACTGTTTTTCTGAAGTGGG - Intergenic
917577294 1:176337172-176337194 ACAGACTGTATTTCTGCAGTAGG + Intergenic
918115109 1:181489461-181489483 AGACCTTTGTTTTCTGCAGTGGG + Intronic
919500870 1:198336823-198336845 TCTCTCTGGTTCTCTGCAGTTGG + Intergenic
920084482 1:203405284-203405306 ACACCCTGATTTCCTGCTATGGG - Intergenic
921930543 1:220750788-220750810 ACACACTGGTTTTCTGGCCTTGG - Intronic
923159135 1:231302280-231302302 ACTACCTGGTTTTATTCAGTTGG + Intergenic
1063259370 10:4368123-4368145 ACACCCAGCTGTTCTTCAGTAGG - Intergenic
1063367397 10:5499585-5499607 ACCCCCTCCTTTTCTGCAATCGG + Intergenic
1068703907 10:60051685-60051707 ACATCATGGTTTTCTTTAGTCGG - Intronic
1070232138 10:74579729-74579751 ACACACTGGATATCTGCAGAGGG + Intronic
1070933079 10:80274350-80274372 ACAACCAGGCTTTCTGCACTGGG + Intronic
1074968862 10:118519142-118519164 AGACACTGCATTTCTGCAGTGGG - Intergenic
1075446201 10:122515090-122515112 ACACCCTGGCTTTATGAAGCAGG + Intergenic
1075729372 10:124627233-124627255 ACACCCTGGGTGTCTGCATGGGG - Intronic
1076757089 10:132578348-132578370 AGACCCTGGTTCTCTCCACTGGG + Intronic
1079566876 11:21893223-21893245 ATCCCCTGCTTTTCTGCTGTTGG + Intergenic
1080034991 11:27700807-27700829 ACAGCCGGGGTTTCTGCAGAGGG - Intronic
1080037552 11:27724583-27724605 AGACACTGGATTTCTGCAGATGG - Intergenic
1081372916 11:42325918-42325940 AAACCCAGGTTTTCTTCAGTAGG - Intergenic
1082077110 11:47982238-47982260 ACTCCCAGGTTCTCTGCAGGAGG - Intronic
1082672322 11:56049780-56049802 AAATCCTGGTTGTCTGCACTAGG + Intergenic
1082796446 11:57381349-57381371 ACACCCTGGTTTGCTTCAGAAGG + Intergenic
1087654011 11:100901540-100901562 AGACCTTGGTGATCTGCAGTGGG + Intronic
1087900124 11:103631057-103631079 TCACCCTTCTTTTCTGAAGTAGG + Intergenic
1090203737 11:124873687-124873709 ACTCCCCAGTCTTCTGCAGTGGG - Exonic
1090593639 11:128297223-128297245 ACAGCCTGGCTTTCTGCAGAGGG + Intergenic
1091292628 11:134450383-134450405 AGACACTGGTTTGCTGCCGTAGG - Intergenic
1092052964 12:5485999-5486021 ACACCATGGTTTTCTGGAGAAGG + Intronic
1094658106 12:32440693-32440715 AGGCCCTGGGTCTCTGCAGTTGG + Intronic
1095849051 12:46780446-46780468 CCCCTCTGGTTTTCTGCAGATGG + Intronic
1096746075 12:53727651-53727673 ACACCCTCGTTTTCTGTCATAGG - Intronic
1096917668 12:55050754-55050776 ACATACTAGTTATCTGCAGTGGG - Intergenic
1101889892 12:108703820-108703842 ACAGCCTGGTTCTATACAGTGGG + Intronic
1104727881 12:131088762-131088784 CAACCCTGGTCATCTGCAGTGGG - Intronic
1106124654 13:26890452-26890474 ACTCCCTGGGCTCCTGCAGTGGG - Intergenic
1106127571 13:26912882-26912904 GCACCCTGGCTTTCTGGAGTTGG + Intergenic
1109283303 13:60382082-60382104 ACATGCTGTTTTTCAGCAGTAGG + Intergenic
1109376753 13:61505140-61505162 ACATCCTGGTTTCATGCAGGAGG - Intergenic
1109425731 13:62164558-62164580 AAACCCTGGTATAGTGCAGTAGG + Intergenic
1112471455 13:99693480-99693502 ACACCCTCCTTATCTGCTGTGGG + Intronic
1112483554 13:99799808-99799830 ACACCCTGGTTTTCTGGTACAGG + Intronic
1114143523 14:19946007-19946029 ACACACTGGATTGATGCAGTAGG - Intergenic
1117168857 14:53069208-53069230 GAACCCTGGTTTTCCTCAGTGGG + Intronic
1117531651 14:56665754-56665776 ACACCCTGGTGTTCTCCATCTGG + Intronic
1117726549 14:58680304-58680326 TCACCCAGCTTTTCTGCACTTGG + Intergenic
1118349172 14:64961224-64961246 ACATGCTGGTTTCCTGCAGTGGG - Intronic
1119136176 14:72222588-72222610 TCACCCTGCATTTCTGCAATTGG - Intronic
1120031734 14:79649362-79649384 ACTCCCTTGCTTTCTGCTGTAGG - Intronic
1131185660 15:90271853-90271875 ACAGCCTGGATTTCTGCATATGG + Exonic
1132856020 16:2044881-2044903 ACACCCTGGTTTGTTGCCCTGGG + Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1136482907 16:30553808-30553830 GCACTCAGGTTTTCTGGAGTTGG - Exonic
1141965264 16:87437909-87437931 ACACCGTGGTGTGGTGCAGTTGG - Intronic
1142219806 16:88848597-88848619 GCATCCTGGTTTTCTGCAGATGG + Intronic
1142620445 17:1162353-1162375 ACAGCCTGGTTTCCTGGCGTGGG + Intronic
1144429964 17:15182142-15182164 ACACCAAGGTTCTCTGCAGCGGG - Intergenic
1144673490 17:17146269-17146291 ACAGCCTTCATTTCTGCAGTGGG + Intronic
1145819793 17:27823406-27823428 ACCCTCTGGTTTTCTTCATTTGG + Intronic
1145831154 17:27917299-27917321 CCTCCCTCATTTTCTGCAGTTGG + Intergenic
1147452669 17:40515542-40515564 AAACACTGGTTTCCTTCAGTAGG + Intergenic
1152499136 17:80696621-80696643 AGAGCCTGGATCTCTGCAGTGGG + Intronic
1155388725 18:25310101-25310123 ACATGTTGGTTTTCTGCTGTGGG - Intronic
1156364469 18:36413087-36413109 GCACCCTGGTTTTCAGCAAAAGG + Intronic
1156575670 18:38312359-38312381 ACACCCTGAATTTCTGAAGGTGG + Intergenic
1158404807 18:57151619-57151641 GCACCCTGGTTTCCTGCATGGGG - Intergenic
1160904061 19:1444222-1444244 TTCCCTTGGTTTTCTGCAGTTGG + Intergenic
1161704944 19:5815313-5815335 ACACCCTGGTTTTTCACTGTGGG + Intergenic
1165199109 19:34130954-34130976 ACCTCCTGGTTTTCTGCTGCTGG - Intergenic
924958958 2:16825-16847 ACACCTAGGTATTCTGAAGTTGG + Intergenic
928422138 2:31145965-31145987 ACGGCCTTGGTTTCTGCAGTAGG - Intronic
935154862 2:100475145-100475167 ACCCCTTGCTCTTCTGCAGTTGG - Intronic
937866054 2:126752656-126752678 ACACCCAGATTTCCTGGAGTTGG - Intergenic
937894334 2:126967067-126967089 TGACCCTGGTTTTCTGCATGGGG - Intergenic
939888774 2:147710767-147710789 ACACCCTGGTTATCAGCACTCGG + Intergenic
940179229 2:150913642-150913664 GTAATCTGGTTTTCTGCAGTAGG + Intergenic
941881836 2:170488664-170488686 TAAAACTGGTTTTCTGCAGTGGG + Intronic
947724814 2:232390457-232390479 ACACCCTGGGTTCTTTCAGTTGG - Intergenic
948505273 2:238423814-238423836 ACACCCTGACTCTCTGCAGGTGG + Intergenic
948841819 2:240654648-240654670 ATACCAAGGTGTTCTGCAGTAGG - Intergenic
949048735 2:241885474-241885496 ACAGCCTGTTTCTCTGCTGTTGG - Intergenic
1171323917 20:24273828-24273850 ACAGCTTGGTTTTCTACAGTTGG + Intergenic
1172954612 20:38747529-38747551 ACAACCTTTTTTTGTGCAGTGGG - Intergenic
1174427406 20:50441929-50441951 AAACCCTGACTTTCTGCAGCTGG - Intergenic
1174922478 20:54718532-54718554 ATATCCTGGTATTCTCCAGTGGG - Intergenic
1175536860 20:59720908-59720930 TCACCCAGGATTTCTGTAGTGGG + Intronic
1175974553 20:62703952-62703974 TCACCCTGGTTGTGTGCTGTGGG - Intergenic
1177043142 21:16137361-16137383 ACATTTTGGTTTTCTGCATTAGG + Intergenic
1178251848 21:31010626-31010648 AAAACCATGTTTTCTGCAGTTGG + Intergenic
1179310024 21:40186962-40186984 ACATCCTGGCTTTCTGCTGTGGG - Intronic
1181466703 22:23114280-23114302 ACTCCCAGCTTTTCTACAGTGGG + Intronic
1182077904 22:27507319-27507341 ATAACCTGGTTTGCTGGAGTGGG - Intergenic
1182821142 22:33217341-33217363 ACCCCCAGAGTTTCTGCAGTTGG - Intronic
1183326647 22:37198159-37198181 GTACCCTGGGTTTCTGCATTGGG - Intronic
1183886959 22:40891909-40891931 ACAACGTGGGTTTCTGCTGTGGG + Intronic
949497940 3:4651186-4651208 ACACCTTGTTTTTCTTCATTTGG + Intronic
949596858 3:5557068-5557090 ACACCATGGTTTTCTGAAGTAGG - Intergenic
950839527 3:15953794-15953816 GTACCCTGTTTTTCTGCAATAGG + Intergenic
952195239 3:31068517-31068539 ACACCATCGTTTCCTGAAGTAGG + Intergenic
958982162 3:100734486-100734508 ACACTGTGGTTTTCTGCCATTGG + Intronic
960583880 3:119303216-119303238 AAACACTGGTTTTCTGAAGAAGG - Intronic
963009874 3:140759136-140759158 ACACCCTGGCTATGTGCATTTGG - Intergenic
968448225 4:663198-663220 TCACCCTCGGTTTCTGCTGTGGG + Intronic
970867685 4:20777908-20777930 GCTCCCTGGTTTTCTTCATTAGG - Intronic
973937852 4:55868344-55868366 ACACTCTGATTTTCTCCACTTGG - Exonic
975516480 4:75253890-75253912 CCAACCTGCTTTCCTGCAGTTGG - Intergenic
975830799 4:78366569-78366591 ACAGACTTGTTTTCTGCTGTAGG - Intronic
979087878 4:116437308-116437330 ACACCCTGGTTTCCAACATTTGG - Intergenic
980029315 4:127808304-127808326 ACAGCAGGGTTTACTGCAGTCGG + Intronic
985051572 4:185997406-185997428 ACACTCTGGGATTCTGCAGGCGG + Intergenic
986431853 5:7689064-7689086 ACCCCCTGGTTTTTTCAAGTGGG + Intronic
987591239 5:19929901-19929923 ACACAATGGCTTTCTGCAGCAGG + Intronic
988455527 5:31384049-31384071 CCTCTCTGGATTTCTGCAGTTGG - Intergenic
994881285 5:105499884-105499906 ACACCTCTGTTTTCTGAAGTGGG + Intergenic
998237227 5:140408598-140408620 CCATCCTGATTTTCTCCAGTAGG + Intronic
1000191344 5:158914058-158914080 ACACCCTGTCTTTCTCCACTTGG + Intronic
1001211468 5:169813810-169813832 ACAGCCTTGGTTCCTGCAGTAGG + Intronic
1001763362 5:174225406-174225428 AGACCCTGCTTCTCTGGAGTGGG - Intronic
1004488614 6:16092424-16092446 AAACCTTGGTTTCCTGCAGGAGG - Intergenic
1005482060 6:26264421-26264443 AGGCCCTGGTTTTATGTAGTTGG + Intergenic
1006014654 6:31070687-31070709 ACAGGCTGGTTTTCTGCCCTGGG + Intergenic
1007028218 6:38599905-38599927 AAATCCTGGTTCTCTACAGTAGG + Intronic
1013365851 6:109437371-109437393 ACATCCTGGTTTTCTCCCCTTGG - Intronic
1013828106 6:114239629-114239651 CTAGCCTCGTTTTCTGCAGTTGG + Intronic
1016283657 6:142448543-142448565 ACACCTTGGTTGTATCCAGTTGG + Intergenic
1017009012 6:150049956-150049978 AATCCCTGGTGTTCTGAAGTCGG + Intergenic
1018478295 6:164165299-164165321 ACACTCTGGTTTGCTACAGCAGG + Intergenic
1019190531 6:170248213-170248235 AGACCCTGGCTGTCTGCAGCAGG - Intergenic
1020138908 7:5601864-5601886 ACACAGGGGTGTTCTGCAGTGGG + Intronic
1020558564 7:9700058-9700080 ATGCCCTGGTTTTCTGCACTCGG - Intergenic
1020591848 7:10148552-10148574 CCAACCTGGTTTTCTGCCCTCGG - Intergenic
1021693615 7:23254497-23254519 AGCCACTGGTTTGCTGCAGTAGG - Intronic
1022132942 7:27420883-27420905 ACACCCATGTTTATTGCAGTAGG + Intergenic
1022521269 7:31008566-31008588 GGACCCTAGTTTTCTGGAGTAGG - Intergenic
1023361682 7:39423384-39423406 ACATCCTGGTCTTCTATAGTGGG + Intronic
1024389246 7:48787824-48787846 CCAACCTGGCTTTCTGCACTTGG - Intergenic
1028629410 7:92918141-92918163 ATACCCTGGCTTTCTTCACTAGG + Intergenic
1028783587 7:94766327-94766349 ATATCCTGATTTTCTGCAGCAGG + Intergenic
1033044608 7:137950310-137950332 ACACCCTGGATTTCTCCAGAGGG + Intronic
1034434887 7:151058680-151058702 ACACCCTGGCTGACTCCAGTGGG - Exonic
1037107722 8:15129887-15129909 ACAGCCTTGTTTTATGAAGTCGG + Intronic
1037271192 8:17132268-17132290 ACAGCCCTTTTTTCTGCAGTTGG + Intergenic
1037893891 8:22639123-22639145 TCAGCCTGGTTTTCTCCAGCAGG + Intronic
1038138549 8:24817223-24817245 ACACCTTGGCTTTCTGCCATGGG - Intergenic
1038664885 8:29529462-29529484 ACCCCCTACTTGTCTGCAGTGGG - Intergenic
1044606633 8:94053721-94053743 AACCCATGGTGTTCTGCAGTAGG + Intergenic
1047445239 8:124913575-124913597 ACACACTGTGTTTATGCAGTGGG - Intergenic
1047634447 8:126744771-126744793 GCACCCAGGTTTTCAGCAGATGG - Intergenic
1049569821 8:143364123-143364145 GCACACTGGGTTTCTGCAGTGGG - Intergenic
1050254155 9:3776763-3776785 ACACTCTGTTCTTCTCCAGTTGG + Intergenic
1055010957 9:71564527-71564549 ACACCCTGGAGTTCTGTACTTGG - Intergenic
1057029906 9:91767716-91767738 TGCCCCTGGTTTTCTGCAGCTGG - Intronic
1057703536 9:97381372-97381394 ACACCCAGCAATTCTGCAGTGGG - Intergenic
1061877743 9:133553362-133553384 ACACCCTCGTGTCCTGCAGCTGG - Intronic
1062342590 9:136100380-136100402 AGGCCCTGTGTTTCTGCAGTTGG + Intergenic
1185699731 X:2221820-2221842 ACACCCTGGTTTTCTGCAGTGGG + Intronic
1188469436 X:30521158-30521180 ACACCTTTGTTTTCTTCAGAGGG - Intergenic
1189632967 X:42974814-42974836 ACACCCCTTTGTTCTGCAGTTGG + Intergenic
1198021938 X:132667476-132667498 ATACCCAGGTTTTCAACAGTGGG - Intronic
1199919987 X:152390407-152390429 ATACCATGGTTTTCTGCATAAGG - Intronic