ID: 1185700412

View in Genome Browser
Species Human (GRCh38)
Location X:2227197-2227219
Sequence GACACTGAGTTGTTCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 146}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185700412_1185700418 15 Left 1185700412 X:2227197-2227219 CCTGCTGGGAACAACTCAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1185700418 X:2227235-2227257 GGTCAAAGCACCTTTGTTTTGGG 0: 1
1: 0
2: 0
3: 15
4: 167
1185700412_1185700417 14 Left 1185700412 X:2227197-2227219 CCTGCTGGGAACAACTCAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1185700417 X:2227234-2227256 GGGTCAAAGCACCTTTGTTTTGG 0: 1
1: 0
2: 1
3: 12
4: 174
1185700412_1185700414 -7 Left 1185700412 X:2227197-2227219 CCTGCTGGGAACAACTCAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1185700414 X:2227213-2227235 CAGTGTCATCAGCTATGGCCTGG 0: 1
1: 0
2: 2
3: 16
4: 192
1185700412_1185700420 25 Left 1185700412 X:2227197-2227219 CCTGCTGGGAACAACTCAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1185700420 X:2227245-2227267 CCTTTGTTTTGGGTATTCAAAGG 0: 1
1: 0
2: 0
3: 19
4: 205
1185700412_1185700415 -6 Left 1185700412 X:2227197-2227219 CCTGCTGGGAACAACTCAGTGTC 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1185700415 X:2227214-2227236 AGTGTCATCAGCTATGGCCTGGG 0: 1
1: 0
2: 1
3: 12
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185700412 Original CRISPR GACACTGAGTTGTTCCCAGC AGG (reversed) Intronic
901800923 1:11707603-11707625 GACACTGAGTTGGCCTCAGCAGG - Intronic
902350017 1:15847601-15847623 GAAGCTGAGTTCCTCCCAGCCGG - Intergenic
903442791 1:23401089-23401111 CACACTGAGCTGTGCCCAGCAGG - Intronic
904978509 1:34477087-34477109 AACAGTGAGTTGATGCCAGCAGG + Intergenic
905911033 1:41654811-41654833 GACACTGTGTTTCTCCCTGCAGG - Intronic
910465164 1:87491381-87491403 GACACTCAGTAGTTTTCAGCTGG + Intergenic
911092238 1:94026799-94026821 GACAATCAGTTGTTCTCATCTGG - Intronic
914325143 1:146606385-146606407 GACACAGCCTTGTTCCCATCTGG - Intergenic
914359997 1:146926453-146926475 GACACTCAGTGGTTTTCAGCTGG + Intergenic
915558545 1:156673588-156673610 CAGCCTGAGTTGTCCCCAGCTGG - Intronic
918962409 1:191297577-191297599 AATGCTGAGTTGTTCTCAGCGGG + Intergenic
920314992 1:205070590-205070612 GTCTGTGAGTTGTTCCCACCTGG - Intronic
922720329 1:227896952-227896974 GACCCTTAGTGGTCCCCAGCAGG - Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1066308437 10:34170630-34170652 GACACTGGGTTGATCCTAGAAGG + Intronic
1071600129 10:86954964-86954986 AGCACTGAGATTTTCCCAGCTGG - Intronic
1075860762 10:125674826-125674848 GACACTGACCTGATACCAGCAGG + Intronic
1076686566 10:132200823-132200845 GACCCTGGCTTGTTTCCAGCGGG + Exonic
1077705603 11:4482401-4482423 GGCACTGAGTTGTGCCTACCAGG - Intergenic
1078581227 11:12541197-12541219 GACACTGATTTCTCCCCTGCTGG + Intergenic
1079079641 11:17405369-17405391 GACACTGGCTTCTTCCCAGAGGG + Intronic
1080156923 11:29122075-29122097 TAGACTGAGGTTTTCCCAGCAGG + Intergenic
1081482150 11:43499545-43499567 GGCACTGCGTTGTTCACTGCAGG + Intergenic
1081645511 11:44787447-44787469 CACACTGAGTTGTCCACTGCAGG - Intronic
1081786435 11:45751089-45751111 GACACCAAGTTGTTCTCAGTAGG + Intergenic
1083257951 11:61508326-61508348 TACACTGAAGTGATCCCAGCAGG + Intergenic
1090026644 11:123173196-123173218 GGCACTGGCTTGTTCCCAACAGG - Intronic
1091127535 11:133114461-133114483 GAGACTGATTTGGTCCCAGATGG - Intronic
1091884749 12:4008184-4008206 AAAATTGAGCTGTTCCCAGCCGG - Intergenic
1093149797 12:15607220-15607242 GACACTTAGTTTTTCCCAAAGGG - Intergenic
1094608848 12:31973852-31973874 GACACCCAGTTGTTGTCAGCTGG - Intronic
1095420178 12:42017238-42017260 TACACTGTCTTGCTCCCAGCTGG - Intergenic
1097354947 12:58590772-58590794 GACACTAAGTTTTTCCTAGTTGG - Intronic
1100137128 12:91567112-91567134 GAAACTGACTTCTCCCCAGCTGG + Intergenic
1100479977 12:94968582-94968604 GACAAAGATTTGTTCCCAGAAGG + Intronic
1101175969 12:102151844-102151866 GACAGTGAGTTGGTGCCAGGTGG - Intronic
1102567028 12:113803534-113803556 GACACTGAACTGTCCCCATCTGG - Intergenic
1103053755 12:117802645-117802667 GACACTTGGTTTTTCCCAGGGGG - Intronic
1112688348 13:101859716-101859738 GACAGTGGGTTGTTCCCATATGG - Intronic
1113760911 13:112845951-112845973 GACATTGGGTTGTTTCCAGTTGG + Intronic
1117981795 14:61348969-61348991 GACACAGAAGTGTTCCCTGCTGG + Intronic
1118780707 14:69005896-69005918 CAGACTGAATTGTTCACAGCTGG - Intergenic
1118910936 14:70061368-70061390 GACCCTGGGTTATTCCCAGTGGG - Intronic
1120954612 14:90070969-90070991 GATATTGAAATGTTCCCAGCAGG - Intronic
1121446405 14:93981729-93981751 GACACTGGGCTGTTTGCAGCTGG + Intergenic
1123722927 15:23075601-23075623 GACTCTGACTTCTTCCAAGCTGG - Intergenic
1127806286 15:62523920-62523942 AAGACTGAGCTCTTCCCAGCTGG - Intronic
1127862278 15:63004299-63004321 GGCACTGAGTTGGGCCCTGCCGG - Intergenic
1128279936 15:66386658-66386680 GACACAGACTTCTTCTCAGCTGG + Intronic
1129676348 15:77634004-77634026 GCTAATGGGTTGTTCCCAGCAGG - Intronic
1132587214 16:710784-710806 GGCACTGTGGTGTCCCCAGCGGG + Intronic
1132643369 16:988009-988031 GACGCTGGGTTCTCCCCAGCTGG - Intergenic
1135084689 16:19465848-19465870 GACATTGAGCTGTTACCACCTGG - Intronic
1135629050 16:24021639-24021661 GACACTGAGGGGTTCCCACTCGG + Intronic
1136901866 16:34049138-34049160 GACAGTGAATTGACCCCAGCTGG + Intergenic
1138959716 16:62014463-62014485 GACAGTGAATTGTTCCCACAAGG + Intronic
1140008422 16:71104562-71104584 GACACAGCCTTGTTCCCATCTGG + Intronic
1141910123 16:87053139-87053161 GGCAGTGGGTGGTTCCCAGCTGG - Intergenic
1144338186 17:14290895-14290917 GACACTGTGTTCCTCCCATCAGG - Intergenic
1147479035 17:40741461-40741483 GACACTGAGTTGGTGTCAGAAGG + Intergenic
1147726460 17:42568744-42568766 GACACCAGGTTCTTCCCAGCTGG + Intronic
1151704561 17:75759833-75759855 CACACTGAGTTGTTCCTTCCTGG - Intronic
1152340541 17:79721674-79721696 GACAATGAGTCCTCCCCAGCAGG - Intergenic
1153276670 18:3374337-3374359 GATGCTGAGTTGCTCCCCGCTGG + Intergenic
1153948202 18:10035303-10035325 GCCACTGAGCCCTTCCCAGCGGG + Intergenic
1155120953 18:22817944-22817966 TACACTGACTTCTTGCCAGCAGG + Intronic
1159089496 18:63831805-63831827 GAGAATGAGATGTTCCCAGCAGG - Intergenic
1161013546 19:1971420-1971442 GAGACTGAGCTTTTCCCAACAGG + Intronic
1164680335 19:30130372-30130394 GACACTGAGATTTTCCCAAGGGG + Intergenic
1165287431 19:34853525-34853547 GAGACAGAGTTGATCCCTGCTGG - Intergenic
1165788771 19:38478258-38478280 GACACTGAGCTCTTCGGAGCTGG - Intronic
1166828883 19:45626574-45626596 GACGCTGAGATGTTGCCTGCTGG - Intronic
925575138 2:5352420-5352442 AACAGTGAGTTGTAACCAGCAGG + Intergenic
926019816 2:9485159-9485181 GACACTGGCGTGTTTCCAGCAGG - Intronic
926638749 2:15212443-15212465 GAAACTGAGTTCAGCCCAGCTGG - Intronic
928562974 2:32510596-32510618 GATCCTGAGTTGTTCCAAGCTGG - Exonic
931148689 2:59548181-59548203 GTCATTCAGTTGTCCCCAGCAGG - Intergenic
932256925 2:70295642-70295664 GACACTGAATTTTTTCTAGCAGG + Intergenic
932840487 2:75077590-75077612 GACACTGACCTGTTACCTGCAGG - Intronic
937610606 2:123856186-123856208 GGCACTGACTTGATCCCAGAAGG - Intergenic
939291055 2:140195238-140195260 GACAGTTAGATGTTCCCAGCTGG - Intergenic
940366967 2:152859055-152859077 GCCACTGGGGTGTCCCCAGCTGG + Intergenic
941003090 2:160221633-160221655 AACACCGAGGAGTTCCCAGCAGG - Intronic
947993468 2:234506072-234506094 GACACAGAGTTGGTGCCAGCAGG + Intergenic
948595958 2:239079433-239079455 GGCACTCAGTGGTTCCCAGAGGG - Intronic
1169073249 20:2746527-2746549 GGAACTGAGGTGTCCCCAGCAGG - Intronic
1170346862 20:15396836-15396858 GGCAATGAGGTGTTCCCAGTAGG - Intronic
1173404610 20:42753716-42753738 GACACTGATTTGTCCTCTGCTGG - Intronic
1176517639 21:7798077-7798099 GAGACTCAGTTGTTCTCTGCAGG - Intergenic
1177816956 21:25988096-25988118 GACATTCAGATCTTCCCAGCTGG + Intronic
1178651667 21:34428089-34428111 GAGACTCAGTTGTTCTCTGCAGG - Intergenic
1179005347 21:37508978-37509000 GACACCGCGTTCTTCCCACCTGG + Intronic
1181670204 22:24422372-24422394 GACATGAAGTTGTTCCCAGTTGG + Intronic
1183232034 22:36588642-36588664 GACACTGAGTGATGCACAGCTGG - Intronic
1183374960 22:37457736-37457758 GACACTGAGCATTTTCCAGCAGG + Intergenic
1184142215 22:42584564-42584586 GTCACTGAGTGGTCCCCTGCTGG - Exonic
949507624 3:4741994-4742016 GGCAGTGACTTGTCCCCAGCAGG + Intronic
951061112 3:18208320-18208342 GCCACTGAGTTCTTTGCAGCTGG - Intronic
951203177 3:19897207-19897229 CACACTGAGTGGTCCCCACCTGG - Intronic
953628870 3:44594166-44594188 GACACTGGTATGTTCCAAGCAGG + Exonic
965980052 3:174678677-174678699 GCCACTGGGGTGTTACCAGCTGG + Intronic
966423523 3:179757195-179757217 GACACAGAGCCGTTCCCACCTGG - Intronic
967129708 3:186459245-186459267 GACACTGTGCTGATCCCAGTGGG + Intergenic
970078659 4:12254510-12254532 AAGAGTGAATTGTTCCCAGCAGG + Intergenic
970850622 4:20598484-20598506 GAGACTAAGTTGGCCCCAGCAGG + Intronic
975013327 4:69380939-69380961 GGGACTGAGTTGGTTCCAGCTGG + Intronic
980138382 4:128884235-128884257 GGCAATGAGTTCTTCTCAGCTGG + Exonic
981781540 4:148436220-148436242 GACACAGAGTTGATTCCAGCAGG + Exonic
983972234 4:173889742-173889764 GGCACTGAGCTGATGCCAGCAGG + Intergenic
984958148 4:185066400-185066422 TACACTGGGTTGTTTCCATCTGG - Intergenic
986236063 5:5911885-5911907 GACAGTGATTTGTTCACACCGGG + Intergenic
987199648 5:15563047-15563069 GACACTTAGTTGTTTCCTTCTGG + Intronic
989249844 5:39299408-39299430 GACATTTATTTGTTCCCAGACGG - Intronic
990621600 5:57565521-57565543 GACACTGAGCCTTCCCCAGCAGG + Intergenic
1002012207 5:176292354-176292376 GACACTGAACTGTTTCAAGCTGG - Intronic
1002215612 5:177630262-177630284 GACACTGAACTGTTTCAAGCTGG + Intergenic
1005763713 6:28990165-28990187 GTCACAGAATTGTTCCCAACTGG + Intergenic
1006596140 6:35193705-35193727 GACACCGATTTGTCCCCACCAGG - Intergenic
1007586049 6:42990085-42990107 GTCCCTGAGTTGGGCCCAGCTGG + Intronic
1008466263 6:51834225-51834247 GACAATGAGTTGTTCGCTGATGG + Intronic
1015060841 6:128963241-128963263 GATACTAAGTTGTTCACAACTGG + Intronic
1016870441 6:148810958-148810980 GACATTGAGTTTTTCCAAGCTGG + Intronic
1017912480 6:158805985-158806007 GACAATGACCTGTTCCCAGTTGG + Intronic
1021877819 7:25064856-25064878 GCCACTGGAGTGTTCCCAGCAGG + Intergenic
1023124755 7:36944676-36944698 GACATTGATTTGTTGCCTGCTGG + Intronic
1025059317 7:55791038-55791060 GACACTGGGTTGTTTCAACCTGG - Intergenic
1026498434 7:70922826-70922848 GACACCGAGTTGTCCCCATTTGG + Intergenic
1027345380 7:77254217-77254239 GACACAGGGTCCTTCCCAGCAGG - Intronic
1035336257 7:158128852-158128874 GACACTGTGTGTTTCCCTGCAGG - Intronic
1036615515 8:10384569-10384591 GACACTGAGCTGGTCTCAACAGG + Intronic
1036655766 8:10676334-10676356 GACATTGAGGTGTTGCCAGCAGG - Intronic
1037497585 8:19455004-19455026 TGCACTGACTTATTCCCAGCTGG + Intronic
1041876175 8:62690168-62690190 GTCCCGGAGTTTTTCCCAGCAGG + Intronic
1042114198 8:65413815-65413837 GACACTAGGTTATTCCCATCGGG + Intergenic
1042620139 8:70695084-70695106 GGCTCTGTGTTGTTCCCAGGTGG + Intronic
1045130698 8:99148833-99148855 GAAACTGAATTGTTGCCAACAGG - Intronic
1048885912 8:138909718-138909740 GCCTCTGAGTTGCTTCCAGCAGG + Intronic
1048999363 8:139814932-139814954 GGCACCGAGTTGATGCCAGCAGG + Intronic
1050828775 9:9984698-9984720 GACACTGTGGTCCTCCCAGCAGG - Intronic
1060597599 9:124857538-124857560 GACACTAAGATTTTCCCATCTGG - Exonic
1062419425 9:136472670-136472692 GCCACAGAATTGTTCCCAACGGG + Intronic
1203793464 EBV:163723-163745 GACAAGGAGGTGTTCCCAGAGGG - Intergenic
1185700412 X:2227197-2227219 GACACTGAGTTGTTCCCAGCAGG - Intronic
1186238671 X:7542770-7542792 TACACTGAGCTGTTCTCAGTAGG + Intergenic
1187166421 X:16808329-16808351 AACACTGAGTAGTTTCCAGATGG - Intronic
1187902172 X:24035347-24035369 GTCACTGAGTGGTCCCCTGCTGG - Intergenic
1192492996 X:71592684-71592706 GACACTCTGTGGTTCTCAGCAGG + Intronic
1192493248 X:71594894-71594916 GACACTCTGTGGTTCTCAGCAGG + Intronic
1193103055 X:77637502-77637524 GACACTGAGATTTACCCAGAGGG + Intronic
1194151058 X:90325606-90325628 TGCACTGTGTTGTTCCCAGACGG - Intergenic
1195387046 X:104323349-104323371 GCCACAGAGCTGTTCCAAGCTGG + Intergenic
1195647374 X:107247476-107247498 GACACTGACATGTTCCAGGCAGG + Intergenic
1196406270 X:115365858-115365880 GACACAGCGTTGCTCCCCGCTGG - Intergenic
1196710614 X:118758150-118758172 GACACTGTGTTGTTCAAAACTGG - Exonic
1199976664 X:152898306-152898328 GGCCCTGACTTGTCCCCAGCTGG - Intergenic
1201376804 Y:13331242-13331264 GGCACTGGCTTGATCCCAGCTGG - Intronic