ID: 1185715397

View in Genome Browser
Species Human (GRCh38)
Location X:2337986-2338008
Sequence TTGTCTCAGCTGAGGCACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 1, 2: 4, 3: 74, 4: 347}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185715397_1185715399 -5 Left 1185715397 X:2337986-2338008 CCGCTGTGCCTCAGCTGAGACAA 0: 1
1: 1
2: 4
3: 74
4: 347
Right 1185715399 X:2338004-2338026 GACAAAAAAAAAAAAAAAGCTGG 0: 4
1: 117
2: 3313
3: 18968
4: 82937
1185715397_1185715401 26 Left 1185715397 X:2337986-2338008 CCGCTGTGCCTCAGCTGAGACAA 0: 1
1: 1
2: 4
3: 74
4: 347
Right 1185715401 X:2338035-2338057 AGAAATAACAATCCCAGGCCAGG 0: 1
1: 0
2: 9
3: 64
4: 684
1185715397_1185715400 21 Left 1185715397 X:2337986-2338008 CCGCTGTGCCTCAGCTGAGACAA 0: 1
1: 1
2: 4
3: 74
4: 347
Right 1185715400 X:2338030-2338052 CATTTAGAAATAACAATCCCAGG 0: 1
1: 0
2: 0
3: 37
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185715397 Original CRISPR TTGTCTCAGCTGAGGCACAG CGG (reversed) Intronic
900658085 1:3770034-3770056 TTCTCTCAGCTCAGGCAGAGGGG + Intronic
900831062 1:4965647-4965669 CTCCCTCAGCTCAGGCACAGAGG + Intergenic
901543567 1:9938205-9938227 TTGCCTAGGCTGAAGCACAGTGG + Intronic
902492833 1:16797683-16797705 TTGTCTCTACTGAGCCACTGGGG - Intronic
902599461 1:17531311-17531333 GTGGGTCAGCAGAGGCACAGGGG - Intergenic
903043855 1:20552015-20552037 GTCTCTCAGCTCAGGCCCAGCGG + Intergenic
903334780 1:22617585-22617607 ATGTCACAGCTGAGGGTCAGAGG - Intergenic
903420120 1:23212864-23212886 TTGTCTAGGCTGGAGCACAGCGG + Intergenic
903940521 1:26927217-26927239 TTGTCCCAGCTGGAGCACAGTGG + Intronic
903940530 1:26927320-26927342 TTGTCCCAGCTGGAGCACAGTGG + Intronic
904165829 1:28554156-28554178 TTGTCCAAGCTGAAGTACAGTGG - Intronic
904248048 1:29202109-29202131 TTCTCCCAGCTGTGGCAGAGAGG - Intronic
904440714 1:30527695-30527717 TTGTCACCGCTGGGGCCCAGAGG - Intergenic
905199804 1:36307831-36307853 TTGGCTCAGAGTAGGCACAGAGG + Intronic
906430503 1:45751859-45751881 TTGTTTCAGGCCAGGCACAGTGG - Intergenic
906928301 1:50142565-50142587 TTTTCTCATCTGAAGCAGAGTGG - Intronic
908182222 1:61616995-61617017 TAGTCTCAGCTGAACCACATGGG - Intergenic
910199546 1:84684943-84684965 CTGCCTCAGGTGAGGGACAGAGG + Intronic
911177889 1:94835160-94835182 TTGTCACAGGCCAGGCACAGTGG + Intronic
911795804 1:102074611-102074633 ATGACTCATCTGAGGCACGGAGG - Intergenic
912056095 1:105599674-105599696 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
912924708 1:113904007-113904029 CTGTCTCAAATGAGGCAAAGTGG + Intronic
914902456 1:151718108-151718130 GTGTCCCAGCTGAGTCCCAGGGG + Intronic
916181069 1:162084355-162084377 TGGTATCAGCTGAGGCCTAGTGG - Intronic
916523315 1:165585509-165585531 TTGACTCAGCTGAGACTCAGTGG + Intergenic
916832680 1:168509165-168509187 ATGTCTCAGCTGTGAAACAGTGG + Intergenic
917622896 1:176815922-176815944 TTGTCTCAGGTGAGTCTCAGAGG + Intronic
918951782 1:191149918-191149940 TTGTTTCAGGTGAGCCTCAGAGG - Intergenic
919228245 1:194737442-194737464 TTGCCTAGGCTGGGGCACAGTGG + Intergenic
919895070 1:202004584-202004606 AGGACTCATCTGAGGCACAGAGG + Intronic
922324096 1:224512438-224512460 TTGCCTCAGCTGAAGTGCAGAGG - Intronic
923004097 1:230031460-230031482 TTGACCCAGCTGAAGTACAGTGG + Intergenic
923527616 1:234784849-234784871 TTGTCTCTACTGAGCCACTGGGG + Intergenic
924880193 1:248152548-248152570 CTGTCTCTGCTGCAGCACAGAGG + Intergenic
1063434953 10:6022076-6022098 CAGTCTCAGCTGAGACACAAGGG + Intronic
1063575428 10:7257812-7257834 TTGTGAAAGATGAGGCACAGGGG + Intronic
1063797535 10:9529612-9529634 TGGTTAGAGCTGAGGCACAGTGG - Intergenic
1063981693 10:11457687-11457709 TTGTCTCAGCTGAGCCTGACAGG - Intronic
1066652230 10:37667329-37667351 TTGTCCCAGTGGAGGGACAGAGG + Intergenic
1067042156 10:42960710-42960732 CAGTCTCTGCTGAGGCTCAGAGG - Intergenic
1067763442 10:49068235-49068257 TGGCTTCAGCTGTGGCACAGTGG - Intronic
1070064272 10:73018251-73018273 CTGTTTCAGCTCAGGCTCAGGGG - Intronic
1071429658 10:85596705-85596727 GTGCAGCAGCTGAGGCACAGTGG + Intergenic
1071721313 10:88149365-88149387 TTGACAAAACTGAGGCACAGAGG + Intergenic
1072173993 10:92897641-92897663 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
1072261754 10:93682763-93682785 TTGCCTAGGCTGAAGCACAGTGG - Intronic
1072690313 10:97568459-97568481 TTGGCTAGGCTGAGGCTCAGTGG + Intronic
1073058712 10:100719712-100719734 TTTTCTCAGCCGGGGCACGGTGG + Intergenic
1073561685 10:104502450-104502472 TTGTCTCAGCTGATGCCATGTGG - Intergenic
1073729528 10:106272030-106272052 GTTCCTCAGTTGAGGCACAGAGG - Intergenic
1074014216 10:109517018-109517040 TTGTCTAACCTGAGGCCCATGGG - Intergenic
1074078625 10:110151049-110151071 TTTTCTCAGGAGAGACACAGTGG - Intergenic
1074607638 10:114989483-114989505 ATGTCTCAGCTCAAGCAGAGAGG - Intergenic
1075011948 10:118879553-118879575 TTGTCTGAGCTGAAGTACAATGG - Intergenic
1075975520 10:126690775-126690797 TTGTCTCAGATGAGCCTCAGAGG + Intergenic
1076235958 10:128864045-128864067 TGGTGCCAGCTGAGGCCCAGTGG - Intergenic
1078179785 11:9002014-9002036 CTGTCTCAGTTGAGTCACAAAGG - Intronic
1078881331 11:15451860-15451882 TAGTCTCAGCTTAAGCACAGAGG + Intergenic
1078984064 11:16573176-16573198 TTGTCACTTCTGAGGAACAGTGG - Intronic
1079411809 11:20194748-20194770 TTGTCCAACCTGAGGCACACAGG + Intergenic
1080042891 11:27777557-27777579 TTATCTTAGCTGAAGAACAGTGG + Intergenic
1080183690 11:29453828-29453850 ATATCTCAGTTCAGGCACAGAGG - Intergenic
1080310205 11:30881300-30881322 TTGCAGCAGCTGAGACACAGAGG + Intronic
1080508078 11:32937760-32937782 TTGTCACAGCAGAGGGACAGTGG - Intronic
1082192942 11:49269192-49269214 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1083352800 11:62043077-62043099 TTGTCTTAGGTGAGCCTCAGGGG - Intergenic
1083383459 11:62288393-62288415 TTGTCTCAGGTGAGACTCAGAGG + Intergenic
1084668151 11:70587855-70587877 TTGCCTCAGGCCAGGCACAGTGG - Intronic
1086002555 11:81999969-81999991 TTTCCTCAGTTGGGGCACAGAGG + Intergenic
1086458241 11:86980555-86980577 TTCTCTCAGATGAGGGGCAGTGG + Intergenic
1086673188 11:89571882-89571904 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1086901374 11:92371675-92371697 TTGTCCAAGCTGGAGCACAGTGG - Intronic
1087037544 11:93770249-93770271 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
1087320220 11:96649249-96649271 TTGCCTAGGCTGAGGTACAGTGG - Intergenic
1087815603 11:102655010-102655032 GTGTCTTTGCTGAGGCCCAGTGG + Intergenic
1088884829 11:113998580-113998602 TGGTCTCAGCTGAGGAAGAAGGG - Intergenic
1089174249 11:116536831-116536853 TTGTCTCAGATGAGGCAGTGGGG - Intergenic
1089234662 11:117013201-117013223 TTGTATAAGGTCAGGCACAGTGG + Intronic
1089827892 11:121295495-121295517 TTGTGTCAGGTGAGCCTCAGAGG + Intronic
1091065679 11:132509574-132509596 GTGTCGCAGCTGAGCCACTGTGG + Intronic
1091533255 12:1380528-1380550 CTGTCTTAGCTAAGGCAAAGGGG + Intronic
1092063296 12:5568259-5568281 TAGTCCCAGCTGAGGGACTGAGG - Intronic
1092907848 12:13118155-13118177 TTTTCTCAGATGGGGCAAAGTGG + Intronic
1093057629 12:14570416-14570438 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1094302996 12:28986852-28986874 TTGTCACCGCTGAGCCACAGGGG - Intergenic
1097747075 12:63313946-63313968 TTGCCTCAGTTATGGCACAGAGG + Intergenic
1097982704 12:65750858-65750880 TGGTATCAGCTGAAGCAAAGTGG + Intergenic
1101088407 12:101259591-101259613 TTGTCTCAGGCTAGGCGCAGTGG + Intergenic
1101458500 12:104863393-104863415 TTTCCCCAGCTGAAGCACAGTGG - Intronic
1101543648 12:105688987-105689009 TGGTATCAGCAGAGGCCCAGTGG - Intergenic
1104309822 12:127644404-127644426 TTGTGTCAGGGGAGTCACAGAGG + Intergenic
1106714195 13:32370878-32370900 TTGTATCAGGCCAGGCACAGTGG - Intronic
1107174574 13:37385403-37385425 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1107711764 13:43157545-43157567 ATGTCTCAGGTGGGTCACAGAGG - Intergenic
1107753484 13:43594494-43594516 TTGTTTAAGCTGAGGAAGAGGGG + Intronic
1108190570 13:47934281-47934303 TTGTCTCAGGTGAGTCTCAGAGG + Intergenic
1109410340 13:61957306-61957328 TTGTCTCAGCTGATAATCAGTGG - Intergenic
1109423160 13:62139458-62139480 TTGTCTCAGGAGAGACTCAGAGG - Intergenic
1109612133 13:64779875-64779897 TGGTCTCAACTGAGGCTCAGGGG + Intergenic
1109895720 13:68686455-68686477 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1109960441 13:69621891-69621913 TTGTCTCAGGTGAGCCTCAATGG - Intergenic
1113751487 13:112779444-112779466 CTGTCCCAGCTGAAGCACAGCGG - Intronic
1114661322 14:24347027-24347049 TTCTCTCAGCTGAGGGAGAAAGG - Intergenic
1115098979 14:29675084-29675106 TTGTCCCGGCTGTGGCTCAGGGG + Intronic
1115212560 14:30982345-30982367 TTGCCTAAGCTGGAGCACAGTGG + Intronic
1117617332 14:57546894-57546916 TATTCTCAGCTGGGCCACAGAGG + Intergenic
1117926871 14:60790329-60790351 TTGTCTCAGATGAGCCTCAGAGG - Intronic
1118027630 14:61785848-61785870 TTGTCTTAGGTGAGCCTCAGAGG + Intronic
1118279274 14:64413867-64413889 TTGCCTCAGCTGCAGCACAGTGG + Intronic
1118577417 14:67257267-67257289 TTGTCTCAGGTGAACCTCAGAGG + Intronic
1120994955 14:90410037-90410059 TTATCTGAGCCAAGGCACAGTGG - Intergenic
1121087009 14:91154397-91154419 TTGTCTCAGGTGAGCCTCAGAGG + Intronic
1121357387 14:93227218-93227240 CTGCATCAGCTGAGTCACAGAGG - Exonic
1121929326 14:97958080-97958102 TTGCCTCAGCTGCAGTACAGTGG + Intronic
1123744699 15:23310828-23310850 TTGCTTCAGCTGTGGGACAGCGG + Intergenic
1124270093 15:28272339-28272361 TTGCTTCAGCTGTGGGACAGCGG - Exonic
1125833198 15:42730434-42730456 TTGGCTCCCCTGAGGTACAGTGG - Intronic
1126702792 15:51382993-51383015 TTGTCTCATCTGAGCCACTGGGG - Intronic
1127048186 15:55050124-55050146 TGGCCACAGTTGAGGCACAGAGG + Intergenic
1127229070 15:56969047-56969069 TTGTCTCAGGTGAGCCTCAGAGG + Intronic
1128081943 15:64862075-64862097 TGCTGTGAGCTGAGGCACAGCGG + Intronic
1128440226 15:67700191-67700213 TTGTCAAGGCTGAGTCACAGAGG + Intronic
1128952293 15:71898362-71898384 TAGTCTCATTTGAGGCACTGAGG + Exonic
1128977569 15:72164738-72164760 TTGACTCAGCTGAAGAAAAGAGG + Intronic
1131273177 15:90959153-90959175 TATTCACAACTGAGGCACAGAGG - Intronic
1131361081 15:91791227-91791249 CTTTCTCAGCTGGGGCTCAGGGG - Intergenic
1132877683 16:2147736-2147758 TGGTCAGAGCTGGGGCACAGTGG - Intronic
1133719715 16:8483587-8483609 TTGTCTGAGCAGAGCCTCAGAGG - Intergenic
1134093321 16:11403044-11403066 TTGACTCACCTGGGGGACAGAGG - Intronic
1134371704 16:13632051-13632073 TTGTCTCAGGTGAGTCTCGGGGG - Intergenic
1134830296 16:17317343-17317365 TGGCATCAGATGAGGCACAGTGG + Intronic
1135497874 16:22968415-22968437 CTGTCTCTGCTGGGGCACTGGGG + Intergenic
1135843023 16:25893803-25893825 TTATTGCAGATGAGGCACAGAGG - Intronic
1136099987 16:27986927-27986949 TGGTCTCAGTTCAGGCACAGTGG + Intronic
1137372870 16:47924918-47924940 TTGTATAAGCAGAGGCACAGTGG + Intergenic
1138027120 16:53530809-53530831 TTATCTTAAATGAGGCACAGTGG - Intergenic
1138119665 16:54389500-54389522 ATGACTAAACTGAGGCACAGAGG + Intergenic
1139506906 16:67403054-67403076 TTGTCTCAGCTGAGACAGAGAGG + Intronic
1142212270 16:88813877-88813899 TTGTCTCAGGGGAGCCCCAGAGG - Exonic
1143111352 17:4554767-4554789 GTGTCTCAGCTGTGGCGGAGGGG - Intronic
1143362239 17:6381696-6381718 TTTTCTCTGCTGATGCACTGGGG - Intergenic
1143615856 17:8048663-8048685 TTGTCCCAGGAGAGGCACATGGG - Exonic
1144560225 17:16315221-16315243 TTGTTTTATCTGAAGCACAGTGG - Intronic
1144666076 17:17103087-17103109 TTGTCTCCCTTGAGGCAGAGTGG + Intronic
1144668609 17:17118704-17118726 TTCTCTGAGTTGTGGCACAGAGG + Intronic
1145223158 17:21105736-21105758 TTGTCTCAGGGGAGCCTCAGAGG + Intergenic
1145769867 17:27485270-27485292 TGGTCTGAGCTGAGGCAGAGAGG + Intronic
1147257718 17:39191965-39191987 TAGACTCAGCTGAGGTCCAGTGG + Intronic
1147558134 17:41492553-41492575 TTGTGAAAGCTGAGGCTCAGAGG - Intergenic
1147623277 17:41882517-41882539 TTCTCTAAGCCGAAGCACAGGGG + Intronic
1147803315 17:43110546-43110568 TTGTCCCAGCTGGAGTACAGTGG - Intronic
1148021311 17:44556007-44556029 TTGTCTCTCCCGAGGGACAGGGG - Intergenic
1149104133 17:52942259-52942281 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1149297106 17:55271020-55271042 TTGTCACATCTGGGGCACTGGGG - Intronic
1149391514 17:56196214-56196236 TTGCCTAAGCTGGAGCACAGTGG - Intronic
1150161715 17:62903504-62903526 TTGTCTCAGGTGAACCTCAGAGG + Intergenic
1150299654 17:64037600-64037622 TTGTCAAAGATGGGGCACAGAGG - Intergenic
1150336417 17:64333838-64333860 TAGTCCCAGCTGAGTCAGAGGGG + Intronic
1150518937 17:65846606-65846628 TTGCCTAGGCTGAAGCACAGTGG + Intronic
1150683383 17:67301123-67301145 GTGTTTCAGGTGGGGCACAGTGG + Intergenic
1151378298 17:73707000-73707022 TTCTCTCCGCACAGGCACAGCGG + Intergenic
1151776405 17:76206189-76206211 TTGCCCAAGCTGAGGTACAGTGG - Intronic
1153591590 18:6679771-6679793 TTTTGTCAGCTGAGGAACACAGG - Intergenic
1155163908 18:23217866-23217888 GCTTCGCAGCTGAGGCACAGTGG + Intronic
1155168158 18:23247719-23247741 TTCTCTGAGCTGCGGCTCAGTGG - Intronic
1156913024 18:42433851-42433873 TTAGCCCAGCTGAGGGACAGTGG + Intergenic
1157742602 18:50106698-50106720 TTGTGTCAGGGGAGGCACAGAGG - Intronic
1159939711 18:74397578-74397600 CTGTCTGAGCTGAGACACTGAGG - Intergenic
1162388229 19:10373616-10373638 TTGTCTCAAGCCAGGCACAGTGG - Intronic
1162451132 19:10755949-10755971 GTGTCTCAGGTCAGGCACAGTGG - Intronic
1163219883 19:15911343-15911365 TTTTCTCAGATGAGGCAAAAAGG + Intergenic
1164254960 19:23519640-23519662 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1164612135 19:29639718-29639740 TTTTCAGAGCTCAGGCACAGTGG + Intergenic
1164656895 19:29928388-29928410 CTGTCTCCACTGAGGCTCAGGGG - Intronic
1165117039 19:33534802-33534824 TTCTAGCAGGTGAGGCACAGTGG + Intergenic
1165176430 19:33933791-33933813 CTGGCTCAGATGATGCACAGAGG - Intergenic
1165261456 19:34622668-34622690 CTTTCTCAGTTGGGGCACAGAGG + Intronic
1167006989 19:46782626-46782648 TTGTCTCTGCTGGGTCCCAGTGG - Intronic
1167445934 19:49537477-49537499 TTGTATAAGGTGGGGCACAGTGG - Intronic
1167498324 19:49831712-49831734 ATGTATCATCTGGGGCACAGTGG + Intronic
1167785513 19:51632616-51632638 TTGTCCCAGCTGGAGTACAGTGG + Intronic
1168116732 19:54225128-54225150 TTGTCCCAGCTGAAGTACAGGGG - Intronic
1168444650 19:56401491-56401513 TTCTCTCAGGTGAGCCTCAGAGG - Intronic
927162775 2:20284393-20284415 TTGTCTAGGCTGGAGCACAGTGG + Intronic
927201782 2:20582710-20582732 ATGTCCCAACTGAGGGACAGTGG + Intronic
928024280 2:27727405-27727427 TGCTCTCAGCAGAGGCAGAGGGG + Intergenic
930570323 2:53077847-53077869 CTGCTTCAGCTCAGGCACAGTGG - Intergenic
930749842 2:54923803-54923825 TTGTTTCAGCTGAGGGAGGGAGG - Intronic
931152391 2:59588823-59588845 TTGTTTCAGGAGAGGCACAATGG + Intergenic
931257282 2:60584671-60584693 TTGCCTCAGCTGAGGCTTATTGG + Intergenic
932017263 2:68043662-68043684 TTGTCTCAGAAGATTCACAGTGG - Intronic
932586376 2:73032302-73032324 TATGCTCAGCAGAGGCACAGAGG - Intronic
933178390 2:79202155-79202177 TTGTCTCAGGTAAGCCTCAGAGG + Intronic
933575578 2:84063495-84063517 GTTGCTCAGGTGAGGCACAGAGG - Intergenic
933866936 2:86528360-86528382 TTGTCCAGGCTCAGGCACAGTGG + Intronic
934108234 2:88716071-88716093 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
934611748 2:95743493-95743515 TTGACTCAGGCCAGGCACAGTGG + Intergenic
934862695 2:97777773-97777795 TTGTCCAAGCTGGGGCACAGTGG - Intronic
935578598 2:104736210-104736232 CAGTCTCTGCTGAGGCAAAGCGG - Intergenic
935830166 2:106994071-106994093 TTGACTCAGCTGGGGAGCAGAGG + Intergenic
936136348 2:109897654-109897676 TTGTCTCAGGTGAGCCTCAAAGG + Intergenic
936208349 2:110473831-110473853 TTGTCTCAGGTGAGCCTCAAAGG - Intergenic
936545083 2:113385109-113385131 TTGACTCAGGCTAGGCACAGTGG + Intergenic
937029268 2:118724502-118724524 CTTTCTCAGCTGAGCCTCAGAGG - Intergenic
937672100 2:124548964-124548986 ATGCCTCAGCTGGGGCACAAGGG + Intronic
938848014 2:135231746-135231768 TTGCCTCAGCTGAAGTGCAGTGG - Intronic
939128327 2:138204499-138204521 TTGTCTCAGATGAGACACTGCGG - Intergenic
939200802 2:139031491-139031513 TTGCTTCAGCTCTGGCACAGGGG + Intergenic
941059300 2:160827475-160827497 TGGCTTCAGCTCAGGCACAGAGG + Intergenic
941635911 2:167934690-167934712 TTGCCTCGGCTGAAGTACAGTGG - Intergenic
943622510 2:190165395-190165417 TTGTCTAAGCTGGAGTACAGTGG - Intronic
943727472 2:191267089-191267111 TTGTCTCTGCATAGGCAGAGAGG - Intronic
944839085 2:203608210-203608232 TTGTCTGAGCAGTGGTACAGTGG - Intergenic
945292891 2:208143357-208143379 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
945416200 2:209576073-209576095 TTATTTCAGAAGAGGCACAGGGG + Intronic
945915432 2:215698973-215698995 TTGCCTAGGCTGAAGCACAGTGG + Intergenic
946655094 2:221937755-221937777 TTCTCTAAGGCGAGGCACAGTGG - Intergenic
946997523 2:225412076-225412098 TAGTCCCAGCTGAGGGACTGAGG - Intronic
948828025 2:240583429-240583451 TTGTCTCAGGTCGGGCACAGTGG - Intergenic
1169725338 20:8722977-8722999 TTTTCTAAGCTGGAGCACAGTGG - Intronic
1169903595 20:10577679-10577701 TTGCCTCAGCTGGAGTACAGTGG - Intronic
1172705245 20:36877996-36878018 TTCTGTCAGCTGGGGCACCGTGG - Exonic
1172768363 20:37363048-37363070 GTATCTCAGCTGAGGCCCAAAGG - Intronic
1174087771 20:48021185-48021207 CTCTCTCAGCTGGAGCACAGGGG + Intergenic
1174262441 20:49306367-49306389 TTGTCCAGGCTGAAGCACAGTGG - Intergenic
1176388928 21:6153738-6153760 GTGTCCCAGCCGAGGCCCAGAGG + Intergenic
1177649580 21:23943024-23943046 TTGTTTCAGGTGAGCCTCAGAGG + Intergenic
1177722657 21:24928016-24928038 TAGTCTCAGCTGTGGCTCAAAGG + Intergenic
1178448273 21:32665403-32665425 TTGTCTCAGGTGAGTCTCAGAGG - Intronic
1179668369 21:42928022-42928044 TTGTCTCAGGGGAGCCTCAGAGG + Intergenic
1179734544 21:43384510-43384532 GTGTCCCAGCCGAGGCCCAGAGG - Intergenic
1180717898 22:17884350-17884372 TTGTGTCAGCTGGGACACACAGG + Intronic
1182109969 22:27716107-27716129 TTGTCTCAGCTGATGCCATGTGG - Intergenic
1182462568 22:30492794-30492816 TTGTCTCAGGCCAGGCGCAGTGG + Intronic
1183940682 22:41293370-41293392 TTGCCTAGGCTGAAGCACAGTGG - Intergenic
1184588983 22:45468369-45468391 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
949493845 3:4613319-4613341 TTGTCTCAGGTGACCCTCAGAGG + Intronic
949537865 3:5009795-5009817 TGTTCTCAGCAAAGGCACAGTGG - Intergenic
949831485 3:8219629-8219651 GAGACTCAGCTGAGGCAAAGGGG + Intergenic
949868464 3:8566853-8566875 ATGTGGAAGCTGAGGCACAGGGG + Intronic
952141245 3:30481087-30481109 TTGTCTCAGATGAAGCACTTTGG + Intergenic
952788152 3:37176256-37176278 CTGTCTCAGCCGCGGCGCAGAGG - Intronic
953553865 3:43926438-43926460 ATGTCTCATCTCAGGCACATCGG + Intergenic
954391035 3:50267987-50268009 TTGCCCCAGCTGAGGGCCAGGGG + Intronic
956111685 3:65876381-65876403 ATTTCTCAGCTGAGCCACATAGG - Intronic
956510984 3:69993294-69993316 TTCTCTCCTCTGAGGTACAGAGG + Intergenic
959536561 3:107493007-107493029 CTGTCTCAGGCCAGGCACAGTGG + Intergenic
960035780 3:113101907-113101929 TAGTCTCAGCTGACCCAGAGGGG + Intergenic
961007594 3:123415248-123415270 TTGGCTCAGCTGGGGACCAGGGG + Intronic
961108109 3:124259538-124259560 TTGTGGGAACTGAGGCACAGAGG + Intronic
961182800 3:124889182-124889204 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
961259338 3:125587932-125587954 CTGTCTCAGGCCAGGCACAGTGG + Intronic
962052073 3:131826742-131826764 CAGTCTCAGGTCAGGCACAGTGG + Intronic
962686455 3:137852606-137852628 TCGCCTAAGCGGAGGCACAGAGG - Intergenic
962833283 3:139162805-139162827 TTGTCTCAGGTGAGGCACAGAGG + Intronic
963104355 3:141633301-141633323 TTGACTCTGCTGAGGTACAGTGG + Intergenic
963299772 3:143585273-143585295 TTGTCTCAGGTGAGGCTCAGAGG - Intronic
963902585 3:150746604-150746626 TTGTCACAACTGAGGGGCAGGGG - Intronic
964773677 3:160252662-160252684 TTGTCTCAGGTGAGCCTCAGAGG + Intronic
967235858 3:187383079-187383101 TGGCCTCAGCTGAGGCAGCGGGG - Intergenic
967739513 3:192989608-192989630 TAGTCCCAGCTGAGGGACTGAGG - Intergenic
967860176 3:194145290-194145312 TTGTCTCTGGTCAGGCGCAGTGG + Intergenic
968436130 4:590469-590491 TGATCTCATCTGAGGCACAAGGG + Intergenic
968722984 4:2221435-2221457 TTGTCTCAGGTGAACCTCAGAGG - Intronic
968770162 4:2500336-2500358 TTCTCCCAGATGGGGCACAGAGG + Intronic
969217316 4:5732669-5732691 ATGTCTCTGCTAAGGCACCGAGG + Intronic
971075686 4:23146508-23146530 TTGTATCAGACAAGGCACAGTGG + Intergenic
971554967 4:28002198-28002220 CTGTCTCTGCTGAGTCACACAGG + Intergenic
972423180 4:38909207-38909229 ATGAGTAAGCTGAGGCACAGAGG - Intronic
973911696 4:55588281-55588303 TTGTCTCAGGTGAGTCTGAGAGG - Intronic
974073679 4:57148844-57148866 TTGTTTCAGGCCAGGCACAGTGG - Intergenic
974082804 4:57230407-57230429 TTGTCTCAGATGAGCCTCAGAGG + Intergenic
974565645 4:63576230-63576252 TTTCCTCAGTTGGGGCACAGAGG + Intergenic
974609932 4:64204433-64204455 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
974969578 4:68807490-68807512 TTGTCTCAGCTGTGGCTAAAAGG + Intergenic
975265995 4:72368270-72368292 TGGTTTCAACTCAGGCACAGAGG + Intronic
976171240 4:82307028-82307050 TTTTGTCAGGTCAGGCACAGTGG + Intergenic
976695912 4:87919481-87919503 TTGTCTCAGGTGAGCCTCACAGG - Intergenic
977753179 4:100633877-100633899 ATGTCACAGCTGAAGCAGAGAGG + Intronic
977894311 4:102346214-102346236 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
978585309 4:110270258-110270280 TTGTTACAGGTGGGGCACAGTGG - Intergenic
980717893 4:136652055-136652077 TTATTTAAGCTGAAGCACAGTGG + Intergenic
980720652 4:136690551-136690573 TTGTCTCAGATGAGTCAGAGGGG + Intergenic
981039829 4:140212836-140212858 TTGTCTCAGGTGAGCCTCAGCGG - Intergenic
982018230 4:151176916-151176938 TTGTGGCAGCTGAGCCACTGAGG - Exonic
982070358 4:151688846-151688868 CTGTCTCAGAGGAGGCAGAGGGG - Intronic
983583717 4:169334355-169334377 TTGTCTCAGGTGAGACTCAGAGG - Intergenic
983631653 4:169855495-169855517 TTATTTCAGGTCAGGCACAGTGG - Intergenic
985330650 4:188828849-188828871 TTGATTAAGTTGAGGCACAGTGG + Intergenic
985484133 5:139474-139496 TTGTCTCAGGCCAGGTACAGGGG + Intergenic
986163664 5:5253482-5253504 TTGTCTCAGGTGAGCCTCAGAGG + Intronic
986258988 5:6126161-6126183 CTGTCTCTGCTAAGTCACAGAGG - Intergenic
986946429 5:13027634-13027656 TTGTCTCTGATGATCCACAGGGG - Intergenic
987362057 5:17116348-17116370 TTTTCTCTGCTGAGGTAGAGAGG - Intronic
987380628 5:17282505-17282527 ATGTCTGTGCTGAGGCAGAGTGG - Intergenic
988785959 5:34565525-34565547 ATGTCTCAACTGAGGCAAGGGGG - Intergenic
990327482 5:54692547-54692569 ATGTCTCAGCTGAGTCACCCAGG + Intergenic
990594887 5:57302887-57302909 AGGTTTCAGCTGAGGCACTGGGG - Intergenic
990695253 5:58409159-58409181 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
990900931 5:60748080-60748102 TTGCCCCAGCTGGAGCACAGTGG - Intergenic
991264916 5:64706364-64706386 TTGTCTCAGCTGAGCCTCAGAGG + Intronic
991507782 5:67343057-67343079 TTGTGTGAGCTTAGGCACCGGGG - Intergenic
993238346 5:85345149-85345171 TTGTCCAGGCTGAAGCACAGTGG - Intergenic
993348623 5:86818890-86818912 TTTCCTCAGGTGTGGCACAGAGG - Intergenic
994049561 5:95347198-95347220 ATGTCTAAGCTGAGGCCAAGAGG + Intergenic
997199147 5:131999247-131999269 TTGTTTGAGATGAGGCCCAGAGG - Intronic
997627458 5:135340632-135340654 CTCTCTTAGCTGAGGCCCAGTGG - Intronic
997798352 5:136834178-136834200 CTGTCTCTGCTGAGTCACACAGG + Intergenic
999140915 5:149361119-149361141 TAGTGTCAGGTGAGGCACAGTGG + Intronic
999405183 5:151300647-151300669 TGCTGTCAGCTAAGGCACAGTGG - Intronic
999450423 5:151673525-151673547 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
999462688 5:151771026-151771048 TTGTGGCAGCTGAGGCACGGTGG - Intronic
1001179939 5:169510893-169510915 TTGTCACAGCTGAGGCAGAGGGG - Intergenic
1002915142 6:1522958-1522980 TTGCCCCAGCTGGAGCACAGTGG - Intergenic
1003883541 6:10500068-10500090 TTGTTTCAGCTCATACACAGAGG + Intronic
1004538350 6:16524510-16524532 GAGCCTCAGCTGAGTCACAGAGG + Intronic
1005504294 6:26456753-26456775 CTGTCACAGCAGAGACACAGTGG + Intergenic
1005615462 6:27568268-27568290 GTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1005702257 6:28413811-28413833 TTTTCTCAGGTGAAGCAAAGGGG + Intergenic
1006483823 6:34321148-34321170 TTGTCTCAGGCCAGGCACGGTGG + Intronic
1006947090 6:37791754-37791776 TGGAATTAGCTGAGGCACAGAGG - Intergenic
1007054661 6:38870416-38870438 TTGATTAAGCTGAGGAACAGGGG - Exonic
1007156342 6:39748373-39748395 TTGTCTCAGGTGAGTCTCAGAGG + Intergenic
1007273805 6:40658716-40658738 TGGTCTCTGCTGGGCCACAGGGG + Intergenic
1007273934 6:40659884-40659906 TTGTCTCTTCTGAAGCAAAGGGG + Intergenic
1007745025 6:44038411-44038433 TTGCCTCAGGGGAGGCAAAGCGG + Intergenic
1008363977 6:50654237-50654259 TTTTCTCAGCTGGGACACAAGGG - Intergenic
1010317024 6:74463610-74463632 TTATCTCAGGTGAGCCTCAGAGG + Intergenic
1010467449 6:76185496-76185518 TTGTCCCAGCTGAAGTGCAGTGG - Intergenic
1011077934 6:83458001-83458023 TTGACTCCACTGAGGCAGAGGGG - Intergenic
1011790470 6:90893404-90893426 TTATCTCAGCCAAGGCACAAGGG + Intergenic
1012064609 6:94534610-94534632 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1012829621 6:104188014-104188036 TTCTCTCAGCAGAGAGACAGGGG + Intergenic
1013108502 6:107046578-107046600 TTGTGTCTGCTGAGGGACAGGGG + Intronic
1018941272 6:168310121-168310143 GGGTCTCATCTCAGGCACAGGGG - Intronic
1019785546 7:2974863-2974885 GTGTCTCAGGCCAGGCACAGTGG + Intronic
1019808141 7:3144042-3144064 TTTCCTCAGCTGTAGCACAGAGG + Intronic
1020763273 7:12292666-12292688 TTTCCTCAGCTGGGGCACAAAGG - Intergenic
1021461547 7:20892771-20892793 CTGTATCAGCTGAGTCACTGGGG - Intergenic
1021648628 7:22811013-22811035 TTGTGTCAGGTGAGTCTCAGAGG - Intergenic
1023345436 7:39266568-39266590 TTGCCTAAGCTGGGGCACAATGG + Intronic
1023475164 7:40569568-40569590 TTGGCACAGCTGGGGCAAAGAGG + Intronic
1025849249 7:65232428-65232450 TTGTCTCAGATGAGCCTCAGAGG + Intergenic
1027262885 7:76477595-76477617 TAGTCTCAGCTGGGTGACAGAGG + Intronic
1027314267 7:76975704-76975726 TAGTCTCAGCTGGGTGACAGAGG + Intergenic
1027950262 7:84806657-84806679 TTGTCTCAGGCCTGGCACAGTGG + Intergenic
1028501824 7:91527599-91527621 CTGTCTCTGCTGAGTCACACAGG - Intergenic
1028657503 7:93227152-93227174 TTTTCACAGCTGATGCATAGAGG + Intergenic
1029598460 7:101550039-101550061 TGGTGTCGGATGAGGCACAGTGG + Intronic
1030001408 7:105067930-105067952 TCATCTAAGCTGGGGCACAGTGG - Intronic
1030095716 7:105897490-105897512 TAGATACAGCTGAGGCACAGGGG + Intronic
1031621705 7:123941549-123941571 ATGTCTCAGGTGAGCCTCAGTGG + Intronic
1031622133 7:123946823-123946845 ATGTCTCAGGTGAGCCTCAGTGG + Intronic
1032935686 7:136729155-136729177 TTGTCTCTGCTGAGTCATACAGG - Intergenic
1034104281 7:148477184-148477206 TAGTCACAGCTGAGGTACTGGGG - Intergenic
1035048508 7:155984508-155984530 GTATCTCTGCAGAGGCACAGAGG - Intergenic
1035716057 8:1755706-1755728 TTGTCTCTGCTGAGGAAGTGGGG - Intergenic
1037034971 8:14154931-14154953 CTGTCTCAGCTGTCGCCCAGTGG + Intronic
1037742378 8:21617809-21617831 TTTTCTCAGCCTAGGTACAGAGG + Intergenic
1038291438 8:26253095-26253117 CAGTCTCACCTGTGGCACAGTGG - Intergenic
1038445718 8:27602775-27602797 CTATCTCAGGTCAGGCACAGTGG + Intronic
1038889681 8:31705619-31705641 TTCTCTCAGCAGAGAAACAGTGG - Intronic
1039695560 8:39906783-39906805 TTGTTTCAGACCAGGCACAGTGG + Intronic
1040742340 8:50593242-50593264 TTGTCTCAGCTGGACCGCAGTGG - Intronic
1040913568 8:52545322-52545344 TTGTGTCAGGTGAGCCTCAGAGG - Intronic
1042060870 8:64815973-64815995 TTGGCCCAGCTGACCCACAGCGG - Intergenic
1042335330 8:67623955-67623977 TTGTCCAAGCTGAGGTGCAGTGG - Intronic
1042566452 8:70117001-70117023 GTCTTTCAGGTGAGGCACAGTGG - Intronic
1043591269 8:81835942-81835964 TTGTCTCAGATGAGGGACAAGGG - Intronic
1047091862 8:121583887-121583909 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1048094487 8:131276508-131276530 TTGACCCAGGTGAGGCATAGAGG - Intergenic
1048179091 8:132179105-132179127 CTGCCTGAGCTGAGACACAGGGG + Intronic
1048714963 8:137258180-137258202 TTGTCTGTGGTGAGGCACACAGG - Intergenic
1048842428 8:138577502-138577524 TTATCTAAGATGGGGCACAGGGG + Intergenic
1048892662 8:138961680-138961702 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1051876222 9:21796659-21796681 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1053455191 9:38228146-38228168 TTGTCCAAGCTGGGGTACAGTGG + Intergenic
1053536416 9:38930982-38931004 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1054629718 9:67432966-67432988 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1055054465 9:72011023-72011045 TTGTCTCAGGTGAACCTCAGAGG + Intergenic
1056161078 9:83894689-83894711 GTCTCTCAGCAGAGTCACAGAGG - Intronic
1056233177 9:84567476-84567498 TTGTTTCAGCAGAGGTGCAGGGG - Intergenic
1056340601 9:85627657-85627679 CTGTCTCAGCAGGGGCAAAGGGG - Intronic
1056359053 9:85834573-85834595 GTCTCTCAGCAGAGTCACAGAGG + Intergenic
1057286714 9:93762020-93762042 TTGACTCAGAAGAGGCACAAGGG - Intergenic
1057450681 9:95156011-95156033 TTGTTTCAGCCTTGGCACAGTGG - Intronic
1059140679 9:111850187-111850209 GTGTCTAAGCTGAGACTCAGTGG + Intergenic
1059833995 9:118129442-118129464 TTCTTTCAGCAGAGGCACAGGGG + Intergenic
1060840705 9:126791164-126791186 TTGGCTCAGGCCAGGCACAGTGG - Intergenic
1061313783 9:129781190-129781212 TTGTCTAGGCTGGGGTACAGTGG - Intergenic
1062282451 9:135758104-135758126 GTGTCTCGGCTGAGGCCCAAGGG - Intronic
1062282463 9:135758146-135758168 GTGTCTCGGCTGAGGCCCACGGG - Intronic
1062282487 9:135758238-135758260 GTGTCTCGGCTGAGGCCCATGGG - Intronic
1185715397 X:2337986-2338008 TTGTCTCAGCTGAGGCACAGCGG - Intronic
1186034302 X:5404283-5404305 TTGTCTCAGGTGAGCCTTAGAGG + Intergenic
1186121201 X:6363069-6363091 TAGTCTGTGATGAGGCACAGGGG - Intergenic
1186784696 X:12946596-12946618 TTGTCTCACATGAGCCTCAGAGG + Intergenic
1186871856 X:13781488-13781510 TTGTCTCACATGAGCCTCAGAGG - Intronic
1186973732 X:14877004-14877026 TAGTCTGAACTGAGGCACTGAGG + Intronic
1187588834 X:20693427-20693449 TTGTCTCTGCTGAGTCATACAGG - Intergenic
1187657123 X:21488936-21488958 TTGTCTCAGGTGAGCCTCAGAGG - Intronic
1188162599 X:26821473-26821495 CTGTTTCAGCTTAGGTACAGGGG + Intergenic
1188162676 X:26821959-26821981 CTGCTTCAGCTCAGGCACAGGGG + Intergenic
1188430684 X:30103348-30103370 TTGTCTCTGGTGAGCCTCAGAGG + Intergenic
1188905650 X:35788008-35788030 TTCTCTCAGGTGAGCCTCAGAGG - Intergenic
1189032124 X:37461219-37461241 TTGTCTTAGCTTGGGCTCAGAGG + Intronic
1189363617 X:40371536-40371558 CAGGCTCACCTGAGGCACAGTGG - Intergenic
1192162741 X:68800747-68800769 CTGTGTAAGCTGAGGCTCAGGGG - Intergenic
1192235854 X:69295519-69295541 ATGCCTCAGCTGGGGCAGAGTGG - Intergenic
1192410983 X:70931860-70931882 ATGTGTAAGCTGAGGCTCAGAGG + Intergenic
1193124617 X:77858228-77858250 TTGCCTAGGCTGAAGCACAGTGG + Intronic
1193213805 X:78839259-78839281 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1193319705 X:80106928-80106950 TTGTCTCAGGTGAACCTCAGAGG - Intergenic
1193346972 X:80414770-80414792 TTGTCTCAAGTGAGCCTCAGAGG + Intronic
1193693692 X:84680539-84680561 CTGTTTCAGCTTAGGCACAGAGG + Intergenic
1194113875 X:89872606-89872628 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1194485397 X:94479878-94479900 TTGTCTCAGGTGAGCCTCGGAGG - Intergenic
1195853403 X:109306977-109306999 TTTCCTCAGTTGGGGCACAGAGG + Intergenic
1196703830 X:118699276-118699298 TTGTCACAACTGGGGCAAAGAGG + Intergenic
1197673733 X:129307815-129307837 TGGACCAAGCTGAGGCACAGGGG - Intergenic
1197797049 X:130308953-130308975 TTGCCTAGGCTGAAGCACAGTGG - Intergenic
1198070015 X:133139042-133139064 TTGTCTCAGGCCAGGCGCAGTGG + Intergenic
1198450825 X:136766109-136766131 ATGCCTCAGCTGAAGCACAAGGG + Intronic
1198853819 X:140995137-140995159 TTGTCTCAGGTGAGTGTCAGAGG - Intergenic
1199174953 X:144776556-144776578 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic
1199356914 X:146873437-146873459 TTGTCTCAGGTGAGCCTCAGAGG - Intergenic
1200466614 Y:3527961-3527983 TTGTCTCAGGTGAGCCTCAGAGG + Intergenic