ID: 1185721108

View in Genome Browser
Species Human (GRCh38)
Location X:2382171-2382193
Sequence CCACAAGCACAGTCTTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185721100_1185721108 19 Left 1185721100 X:2382129-2382151 CCTACTCTCTGGAGAAGTATTCC 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1185721108 X:2382171-2382193 CCACAAGCACAGTCTTTGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 147
1185721104_1185721108 -7 Left 1185721104 X:2382155-2382177 CCCTCTTTCTGGGCTCCCACAAG 0: 1
1: 0
2: 3
3: 30
4: 278
Right 1185721108 X:2382171-2382193 CCACAAGCACAGTCTTTGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 147
1185721105_1185721108 -8 Left 1185721105 X:2382156-2382178 CCTCTTTCTGGGCTCCCACAAGC 0: 1
1: 0
2: 1
3: 21
4: 313
Right 1185721108 X:2382171-2382193 CCACAAGCACAGTCTTTGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 147
1185721103_1185721108 -2 Left 1185721103 X:2382150-2382172 CCATTCCCTCTTTCTGGGCTCCC 0: 1
1: 2
2: 6
3: 73
4: 709
Right 1185721108 X:2382171-2382193 CCACAAGCACAGTCTTTGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185721108 Original CRISPR CCACAAGCACAGTCTTTGCT TGG Intronic
900409893 1:2507762-2507784 CCCCAAGCACAGGCTGTCCTAGG - Intergenic
900868860 1:5287718-5287740 ACACAAACACATTCTTGGCTCGG - Intergenic
901261683 1:7876020-7876042 GCACAGGCACAGTCTATGGTGGG - Intergenic
902227337 1:15004897-15004919 CTTCAAGCACACTCGTTGCTGGG + Intronic
905024620 1:34841128-34841150 CCACAACTACAATCTATGCTTGG + Intronic
905293829 1:36941668-36941690 CCACAAGCACCTGCTGTGCTGGG + Intronic
908645196 1:66270630-66270652 GCACAAGCAGAACCTTTGCTTGG + Intronic
909825985 1:80127575-80127597 CCACACACACTGTCTTTACTGGG - Intergenic
912090466 1:106067435-106067457 TCAAAAGCACAGTCTCTCCTGGG - Intergenic
913372906 1:118120623-118120645 CCACAAGCAATATCTTAGCTTGG - Intronic
916529282 1:165640425-165640447 CCACAGTCACAGTCTTGTCTTGG - Intronic
917710776 1:177681814-177681836 CCCCAAGTACAGCCTTTGATTGG - Intergenic
919840914 1:201608884-201608906 GCTCAAGCACAGTTTTAGCTTGG + Intergenic
922869069 1:228885423-228885445 CCTCAAGCATAGTCTTTGAATGG + Intergenic
923791543 1:237115316-237115338 CAAGAAGCACGGTCTTTGATAGG + Intronic
924003086 1:239575475-239575497 CAACAACCACAGTATTTGTTTGG + Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1065207403 10:23370224-23370246 ACAAAAGCACAGTCTTCCCTGGG - Intergenic
1067670124 10:48312518-48312540 ACACAAGCACTTGCTTTGCTTGG + Intronic
1075278824 10:121121191-121121213 CCATAACCACAGACTATGCTTGG + Intergenic
1075818611 10:125286003-125286025 GGTCAACCACAGTCTTTGCTGGG + Intergenic
1076514574 10:131036700-131036722 CCACAAGCACAGGGTCCGCTTGG - Intergenic
1077143834 11:1036181-1036203 ACAGAGGCACAGTCTCTGCTGGG - Intronic
1080245731 11:30177468-30177490 CCCCATACAGAGTCTTTGCTGGG - Intergenic
1081310806 11:41569418-41569440 CCTCAAGCATACTCTTTCCTTGG - Intergenic
1083489823 11:63008084-63008106 CCACAATCCCAGCCTATGCTGGG - Intronic
1083557538 11:63643367-63643389 CCACAAGCCCTGACTTTGATGGG - Exonic
1084665004 11:70571623-70571645 CCCCAAGGACAGAATTTGCTAGG - Intronic
1089623479 11:119736362-119736384 GCACAAGGACAGTGTTTGCATGG + Intergenic
1089781837 11:120878686-120878708 CATCACGCACAGTTTTTGCTTGG - Intronic
1090168696 11:124579101-124579123 CTACAAGCAGAGTTTTGGCTGGG - Intergenic
1091262005 11:134241996-134242018 CCACAAGCAACGTTTTTGTTGGG + Intronic
1101444427 12:104727426-104727448 CCATAGCCACAGTCTGTGCTGGG - Intronic
1102071893 12:110027117-110027139 CCACATGCAATGTTTTTGCTTGG - Intronic
1102721728 12:115022323-115022345 CCAGAAACACAGTGTTTTCTGGG - Intergenic
1104073911 12:125372836-125372858 CCACACACACCGTCTTTTCTAGG + Intronic
1104404868 12:128508930-128508952 CCTAAAGCTCAGTCTTTGTTAGG - Intronic
1104532582 12:129586353-129586375 CCACAAGCACAATCTAAGATAGG - Intronic
1105514053 13:21075547-21075569 CCACAAGGCCAGTCTCTGCTAGG - Intergenic
1107524285 13:41214475-41214497 CCACAAGGACTGTAGTTGCTAGG - Intergenic
1110021823 13:70483088-70483110 CCAGAAGCAAAGGCTTTGCTAGG + Intergenic
1110859889 13:80337081-80337103 CGACAAGCAGTGCCTTTGCTCGG - Exonic
1110984546 13:81948557-81948579 CACCAAGCATAGTATTTGCTAGG + Intergenic
1114486156 14:23063087-23063109 CCACAAGAACAGCTTTTGGTAGG + Intronic
1116666332 14:47780390-47780412 CATAAAGCTCAGTCTTTGCTTGG - Intergenic
1118144691 14:63123011-63123033 CCACAACCACCAGCTTTGCTGGG + Intergenic
1119518711 14:75269528-75269550 CCACGTGCCCAGTCATTGCTGGG + Intergenic
1123044201 14:105503430-105503452 CCGGAAGCACTGTCTTTACTTGG - Intergenic
1123925963 15:25110925-25110947 CCAGTACCACAGTCCTTGCTGGG - Intergenic
1124582350 15:30969853-30969875 CCACTGTCACACTCTTTGCTTGG + Intronic
1126317600 15:47386956-47386978 CCACAATGACAGTGTTTGCAGGG - Intronic
1126331979 15:47542877-47542899 ACAGATGCACAGTCATTGCTAGG - Intronic
1129405602 15:75315127-75315149 TCACAAGCACAGTCTGCTCTGGG + Intergenic
1132915410 16:2341142-2341164 CCTCACGCACTGTCTTTCCTTGG + Intergenic
1134745419 16:16584411-16584433 TAAGAAGAACAGTCTTTGCTGGG + Intergenic
1135514456 16:23118700-23118722 CACCAAGCACTGTATTTGCTAGG - Intronic
1135758430 16:25117202-25117224 CCACAACCATAGCCCTTGCTTGG + Intronic
1137034231 16:35555678-35555700 TCACAAGCTCACTGTTTGCTGGG + Intergenic
1139090257 16:63637616-63637638 CCACAAGCAATTTCTTTACTAGG - Intergenic
1146688695 17:34858222-34858244 CCAGAACCAGAGTCCTTGCTGGG - Intergenic
1147715719 17:42506790-42506812 TCACAAACACAGTCTTTTGTAGG - Intronic
1154024579 18:10695528-10695550 CCACAAGCTGAGACATTGCTAGG + Intronic
1156859714 18:41821655-41821677 CCAACAGCACAGTCTTTGGGAGG + Intergenic
1156905919 18:42351981-42352003 CTAGAAGCACAGGCCTTGCTAGG - Intergenic
1157686991 18:49650703-49650725 CCAAGAGCACTGTCTTAGCTGGG + Intergenic
1162631917 19:11934882-11934904 CCATAATTACAGTCTTTGGTCGG + Intronic
1166175741 19:41068229-41068251 CCCTTAGCACAGACTTTGCTTGG + Intergenic
925526986 2:4813969-4813991 CCCCAAGCAGAGTCTCTACTGGG - Intergenic
928199618 2:29239374-29239396 CCTGAAGCACAGCTTTTGCTTGG - Intronic
928456548 2:31427851-31427873 CGACAAGCACAGTCTGGGCATGG - Intergenic
931499082 2:62844207-62844229 CCAAAATTACAGTCTTTGCTAGG + Intronic
931796869 2:65719602-65719624 CCAAAAGCCCAGACTGTGCTAGG - Intergenic
932729682 2:74209952-74209974 CCACAACCACATTCTTCCCTAGG - Exonic
935443818 2:103135836-103135858 CCACAGGAACAGTATTTTCTTGG + Intergenic
936797481 2:116224523-116224545 CCACAAGGGCTGTCCTTGCTTGG - Intergenic
941354843 2:164477982-164478004 CCATAACTACAGTTTTTGCTGGG - Intergenic
941711556 2:168719492-168719514 CCTAAAGCACAGTCTTTGAAGGG - Intronic
942147738 2:173043057-173043079 TCACAGGCACAATCTTTGTTAGG + Intronic
942328053 2:174792092-174792114 CCACCAGCATAGCCTCTGCTGGG - Intergenic
945314860 2:208360475-208360497 GCACAAGCACAGTCTCAGCCGGG - Intronic
945425414 2:209694672-209694694 CCTCAACCACAGTCTCTGATGGG - Exonic
946180563 2:217946581-217946603 GCAGAAACACAGGCTTTGCTAGG + Intronic
946868967 2:224068759-224068781 CCACAGGCATAGCCTTTGCCAGG + Intergenic
1170470226 20:16661309-16661331 CCCCAGGCCCAGTTTTTGCTAGG + Intergenic
1173248242 20:41350577-41350599 CCACAGGCATAGTCATTGGTTGG + Intronic
1176053727 20:63134183-63134205 GCACGGGCCCAGTCTTTGCTCGG - Intergenic
1176103876 20:63376715-63376737 CCACAGGCACTTTGTTTGCTTGG - Intronic
1180949008 22:19712559-19712581 CCACAAGCACAGGCTTGCATGGG + Intergenic
1182024670 22:27108813-27108835 CCACAAGCATAGTCTCCGCCAGG + Intergenic
1182056489 22:27359458-27359480 ACACAAACACAGTCTATGCCAGG - Intergenic
1182342182 22:29632336-29632358 CCCCAAGCCCAGTCTTCACTTGG + Intronic
949442901 3:4102740-4102762 CCAGAAGCACAGGATTTGATAGG + Intronic
956280240 3:67548061-67548083 TCATAATCACAGTGTTTGCTAGG + Intronic
956974804 3:74567068-74567090 GCACAAGCACAGTCTGTACAAGG + Intergenic
958083406 3:88775262-88775284 GCACAAAGACAGACTTTGCTTGG + Intergenic
959874341 3:111364130-111364152 CCAGAAGCCCAGGCTCTGCTAGG + Intronic
960037336 3:113115046-113115068 CCCCCAGCAGAGTCTTTGCTTGG + Intergenic
960611527 3:119559192-119559214 CCACAAAAACAATATTTGCTAGG + Intronic
961571854 3:127804886-127804908 CCACCAGCACAGGCTCTGCTGGG + Intronic
962403960 3:135084359-135084381 CCATGAGCACTGTCTTTTCTAGG - Intronic
966392242 3:179464917-179464939 CCACAACCACATTCTTCCCTAGG - Intergenic
974768685 4:66382069-66382091 TCACAATCACTGTTTTTGCTCGG + Intergenic
977707454 4:100087297-100087319 ACCCAACCACATTCTTTGCTAGG + Intergenic
981958974 4:150512693-150512715 CAAAAAGCACTGTCTTTGTTTGG - Intronic
982664392 4:158243844-158243866 CCACAAGTACATTATTTGTTAGG + Intronic
985920786 5:2971108-2971130 CCACGTGCACAGTCCTTCCTGGG - Intergenic
986112201 5:4730600-4730622 CTGGAAGCACAGTCTTTGTTCGG + Intergenic
989380840 5:40808180-40808202 CCACAAGGTCATTGTTTGCTGGG - Intergenic
989484038 5:41967596-41967618 CCACAACCACATTCTTCCCTAGG + Intergenic
993097669 5:83498908-83498930 CCACAAGCACATACTCTGCCTGG + Intronic
1000851059 5:166340843-166340865 CCCCAAGCCAAGTCTGTGCTGGG - Intergenic
1001701364 5:173708902-173708924 CCACAACCACTGTCATTGCTGGG + Intergenic
1002711163 5:181195719-181195741 CCCCTGGCACAGTCTTTGCAGGG + Intronic
1003289646 6:4768793-4768815 TGACAAGCACTGTATTTGCTAGG + Intronic
1004740659 6:18457231-18457253 CCACCAGCACAGGCTGTCCTGGG - Exonic
1005821754 6:29604667-29604689 TCACTAGTACAGTCCTTGCTGGG - Intronic
1007411307 6:41663560-41663582 CCACAATCACAGATTCTGCTAGG - Intergenic
1009599742 6:65783425-65783447 CCACAACTACAGTCCTTGGTGGG - Intergenic
1010777838 6:79907205-79907227 CCACAACCACAGCCCCTGCTGGG - Intergenic
1013182341 6:107728757-107728779 CCACCAGCACATCCTTTGCCTGG - Intronic
1013224689 6:108112322-108112344 CCACAAGCATTTTCTTTTCTTGG - Intronic
1014239698 6:119001832-119001854 CCACAAGGACAGATTTTACTGGG - Intronic
1016907842 6:149169193-149169215 CCCCAACCACCTTCTTTGCTGGG - Intergenic
1018755113 6:166842178-166842200 TCCCAAGCACAGTATCTGCTAGG + Intronic
1023513375 7:40976899-40976921 CCACATGCACCCTCTTTCCTTGG + Intergenic
1024601181 7:50982896-50982918 CCACCAGCACAGTCCCTGCACGG - Intergenic
1027786780 7:82590240-82590262 CCACAACCACACTCTTCCCTAGG + Intergenic
1028085978 7:86638418-86638440 CTCTAAGCACAGTCATTGCTTGG - Intergenic
1032063858 7:128749172-128749194 GCACAAGCCAAGTCTTTGATGGG + Intronic
1034279186 7:149839796-149839818 CCATAAGCTCCATCTTTGCTTGG - Intronic
1036707246 8:11055021-11055043 CCACACCCAGAGGCTTTGCTTGG + Intronic
1037327844 8:17712156-17712178 CAAAAAGCACAGTATTTGCAAGG + Intronic
1038302808 8:26370249-26370271 CCACTTGCACAGACTTTGCGAGG - Exonic
1041224924 8:55688622-55688644 CCACAAGTACAATGTTTACTTGG + Intergenic
1045480843 8:102590927-102590949 CCACCTGCACAGTCTTGACTGGG + Intergenic
1047001454 8:120577220-120577242 TCAGAAGCACAGTTTTTGTTTGG - Intronic
1047772205 8:128038592-128038614 CCTGAAGCACAGTCTTCACTTGG + Intergenic
1048707423 8:137169472-137169494 CCACAAACACAGCCTTTGGTAGG - Intergenic
1052512019 9:29434374-29434396 CTTCAAGCACATTCTTTGTTTGG + Intergenic
1053305213 9:36980136-36980158 CCCTAAGCATAGTCTTGGCTTGG - Intronic
1053410437 9:37913013-37913035 CCACAAGCACAAACTTTGTGTGG + Intronic
1053516794 9:38737274-38737296 ACACAAACACAGCCTTTGCTTGG + Intergenic
1057140068 9:92721064-92721086 CCACACGTACAGTCCTGGCTTGG - Intronic
1060599867 9:124870232-124870254 CCACAAGAACAGTCATTTCCAGG - Intronic
1061379794 9:130247746-130247768 CCAAAAGCACAGTCTATGACAGG - Intergenic
1185721108 X:2382171-2382193 CCACAAGCACAGTCTTTGCTTGG + Intronic
1185780410 X:2839404-2839426 CCACATCCACCATCTTTGCTTGG + Intronic
1188518002 X:31008077-31008099 CCAAGAGCAAAATCTTTGCTGGG + Intergenic
1189323648 X:40100426-40100448 CCCCAGGCACAGGCTTTTCTCGG + Intronic
1189479682 X:41382998-41383020 GCCCTAGCTCAGTCTTTGCTGGG + Intergenic
1189889096 X:45580585-45580607 CTACAAGGACTGGCTTTGCTGGG + Intergenic
1191586421 X:62832112-62832134 CCAAAAGCACAGTCTCTGAAAGG + Intergenic
1191881005 X:65843686-65843708 CCACAATCTCTGTCTCTGCTGGG + Intergenic
1193080959 X:77405463-77405485 CAACAAGACCAGTCTTTGTTGGG + Intergenic
1195020695 X:100824240-100824262 CCTCAGGCCCAGTCTTTGGTAGG + Exonic
1199690552 X:150306093-150306115 CCTCAAGAACAGGCTTTGCCTGG + Intergenic